| 
									
										
										
										
											2012-04-09 17:03:32 +02:00
										 |  |  | 
 | 
					
						
							|  |  |  | # Various microbenchmarks comparing unicode and byte string performance | 
					
						
							|  |  |  | # Please keep this file both 2.x and 3.x compatible! | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | import timeit | 
					
						
							|  |  |  | import itertools | 
					
						
							|  |  |  | import operator | 
					
						
							|  |  |  | import re | 
					
						
							|  |  |  | import sys | 
					
						
							|  |  |  | import datetime | 
					
						
							|  |  |  | import optparse | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | VERSION = '2.0' | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | def p(*args): | 
					
						
							|  |  |  |     sys.stdout.write(' '.join(str(s) for s in args) + '\n') | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | if sys.version_info >= (3,): | 
					
						
							|  |  |  |     BYTES = bytes_from_str = lambda x: x.encode('ascii') | 
					
						
							|  |  |  |     UNICODE = unicode_from_str = lambda x: x | 
					
						
							|  |  |  | else: | 
					
						
							|  |  |  |     BYTES = bytes_from_str = lambda x: x | 
					
						
							|  |  |  |     UNICODE = unicode_from_str = lambda x: x.decode('ascii') | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | class UnsupportedType(TypeError): | 
					
						
							|  |  |  |     pass | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | p('stringbench v%s' % VERSION) | 
					
						
							|  |  |  | p(sys.version) | 
					
						
							|  |  |  | p(datetime.datetime.now()) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | REPEAT = 1 | 
					
						
							|  |  |  | REPEAT = 3 | 
					
						
							|  |  |  | #REPEAT = 7 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | if __name__ != "__main__": | 
					
						
							|  |  |  |     raise SystemExit("Must run as main program") | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | parser = optparse.OptionParser() | 
					
						
							|  |  |  | parser.add_option("-R", "--skip-re", dest="skip_re", | 
					
						
							|  |  |  |                   action="store_true", | 
					
						
							|  |  |  |                   help="skip regular expression tests") | 
					
						
							|  |  |  | parser.add_option("-8", "--8-bit", dest="bytes_only", | 
					
						
							|  |  |  |                   action="store_true", | 
					
						
							|  |  |  |                   help="only do 8-bit string benchmarks") | 
					
						
							|  |  |  | parser.add_option("-u", "--unicode", dest="unicode_only", | 
					
						
							|  |  |  |                   action="store_true", | 
					
						
							|  |  |  |                   help="only do Unicode string benchmarks") | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | _RANGE_1000 = list(range(1000)) | 
					
						
							|  |  |  | _RANGE_100 = list(range(100)) | 
					
						
							|  |  |  | _RANGE_10 = list(range(10)) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | dups = {} | 
					
						
							|  |  |  | def bench(s, group, repeat_count): | 
					
						
							|  |  |  |     def blah(f): | 
					
						
							|  |  |  |         if f.__name__ in dups: | 
					
						
							|  |  |  |             raise AssertionError("Multiple functions with same name: %r" % | 
					
						
							|  |  |  |                                  (f.__name__,)) | 
					
						
							|  |  |  |         dups[f.__name__] = 1 | 
					
						
							|  |  |  |         f.comment = s | 
					
						
							|  |  |  |         f.is_bench = True | 
					
						
							|  |  |  |         f.group = group | 
					
						
							|  |  |  |         f.repeat_count = repeat_count | 
					
						
							|  |  |  |         return f | 
					
						
							|  |  |  |     return blah | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | def uses_re(f): | 
					
						
							|  |  |  |     f.uses_re = True | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | ####### 'in' comparisons | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"A" in "A"*1000', "early match, single character", 1000) | 
					
						
							|  |  |  | def in_test_quick_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("A") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s2 in s1 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"B" in "A"*1000', "no match, single character", 1000) | 
					
						
							|  |  |  | def in_test_no_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("B") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s2 in s1 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"AB" in "AB"*1000', "early match, two characters", 1000) | 
					
						
							|  |  |  | def in_test_quick_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("AB") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s2 in s1 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"BC" in "AB"*1000', "no match, two characters", 1000) | 
					
						
							|  |  |  | def in_test_no_match_two_character(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s2 in s1 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000) | 
					
						
							|  |  |  | def in_test_slow_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 300+"C") | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s2 in s1 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s="ABC"*33; (s+"E") in ((s+"D")*300+s+"E")', | 
					
						
							|  |  |  |        "late match, 100 characters", 100) | 
					
						
							|  |  |  | def in_test_slow_match_100_characters(STR): | 
					
						
							|  |  |  |     m = STR("ABC"*33) | 
					
						
							|  |  |  |     d = STR("D") | 
					
						
							|  |  |  |     e = STR("E") | 
					
						
							|  |  |  |     s1 = (m+d)*300 + m+e | 
					
						
							|  |  |  |     s2 = m+e | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         s2 in s1 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | # Try with regex | 
					
						
							|  |  |  | @uses_re | 
					
						
							|  |  |  | @bench('s="ABC"*33; re.compile(s+"D").search((s+"D")*300+s+"E")', | 
					
						
							|  |  |  |        "late match, 100 characters", 100) | 
					
						
							|  |  |  | def re_test_slow_match_100_characters(STR): | 
					
						
							|  |  |  |     m = STR("ABC"*33) | 
					
						
							|  |  |  |     d = STR("D") | 
					
						
							|  |  |  |     e = STR("E") | 
					
						
							|  |  |  |     s1 = (m+d)*300 + m+e | 
					
						
							|  |  |  |     s2 = m+e | 
					
						
							|  |  |  |     pat = re.compile(s2) | 
					
						
							|  |  |  |     search = pat.search | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         search(s1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### same tests as 'in' but use 'find' | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).find("A")', "early match, single character", 1000) | 
					
						
							|  |  |  | def find_test_quick_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("A") | 
					
						
							|  |  |  |     s1_find = s1.find | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_find(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).find("B")', "no match, single character", 1000) | 
					
						
							|  |  |  | def find_test_no_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("B") | 
					
						
							|  |  |  |     s1_find = s1.find | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_find(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).find("AB")', "early match, two characters", 1000) | 
					
						
							|  |  |  | def find_test_quick_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("AB") | 
					
						
							|  |  |  |     s1_find = s1.find | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_find(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).find("BC")', "no match, two characters", 1000) | 
					
						
							|  |  |  | def find_test_no_match_two_character(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     s1_find = s1.find | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_find(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).find("CA")', "no match, two characters", 1000) | 
					
						
							|  |  |  | def find_test_no_match_two_character_bis(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("CA") | 
					
						
							|  |  |  |     s1_find = s1.find | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_find(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000) | 
					
						
							|  |  |  | def find_test_slow_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 300+"C") | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     s1_find = s1.find | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_find(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*300+"CA").find("CA")', "late match, two characters", 1000) | 
					
						
							|  |  |  | def find_test_slow_match_two_characters_bis(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 300+"CA") | 
					
						
							|  |  |  |     s2 = STR("CA") | 
					
						
							|  |  |  |     s1_find = s1.find | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_find(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s="ABC"*33; ((s+"D")*500+s+"E").find(s+"E")', | 
					
						
							|  |  |  |        "late match, 100 characters", 100) | 
					
						
							|  |  |  | def find_test_slow_match_100_characters(STR): | 
					
						
							|  |  |  |     m = STR("ABC"*33) | 
					
						
							|  |  |  |     d = STR("D") | 
					
						
							|  |  |  |     e = STR("E") | 
					
						
							|  |  |  |     s1 = (m+d)*500 + m+e | 
					
						
							|  |  |  |     s2 = m+e | 
					
						
							|  |  |  |     s1_find = s1.find | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         s1_find(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s="ABC"*33; ((s+"D")*500+"E"+s).find("E"+s)', | 
					
						
							|  |  |  |        "late match, 100 characters", 100) | 
					
						
							|  |  |  | def find_test_slow_match_100_characters_bis(STR): | 
					
						
							|  |  |  |     m = STR("ABC"*33) | 
					
						
							|  |  |  |     d = STR("D") | 
					
						
							|  |  |  |     e = STR("E") | 
					
						
							|  |  |  |     s1 = (m+d)*500 + e+m | 
					
						
							|  |  |  |     s2 = e+m | 
					
						
							|  |  |  |     s1_find = s1.find | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         s1_find(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### Same tests for 'rfind' | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).rfind("A")', "early match, single character", 1000) | 
					
						
							|  |  |  | def rfind_test_quick_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("A") | 
					
						
							|  |  |  |     s1_rfind = s1.rfind | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rfind(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).rfind("B")', "no match, single character", 1000) | 
					
						
							|  |  |  | def rfind_test_no_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("B") | 
					
						
							|  |  |  |     s1_rfind = s1.rfind | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rfind(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).rfind("AB")', "early match, two characters", 1000) | 
					
						
							|  |  |  | def rfind_test_quick_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("AB") | 
					
						
							|  |  |  |     s1_rfind = s1.rfind | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rfind(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).rfind("BC")', "no match, two characters", 1000) | 
					
						
							|  |  |  | def rfind_test_no_match_two_character(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     s1_rfind = s1.rfind | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rfind(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).rfind("CA")', "no match, two characters", 1000) | 
					
						
							|  |  |  | def rfind_test_no_match_two_character_bis(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("CA") | 
					
						
							|  |  |  |     s1_rfind = s1.rfind | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rfind(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("C"+"AB"*300).rfind("CA")', "late match, two characters", 1000) | 
					
						
							|  |  |  | def rfind_test_slow_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("C" + "AB" * 300) | 
					
						
							|  |  |  |     s2 = STR("CA") | 
					
						
							|  |  |  |     s1_rfind = s1.rfind | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rfind(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("BC"+"AB"*300).rfind("BC")', "late match, two characters", 1000) | 
					
						
							|  |  |  | def rfind_test_slow_match_two_characters_bis(STR): | 
					
						
							|  |  |  |     s1 = STR("BC" + "AB" * 300) | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     s1_rfind = s1.rfind | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rfind(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rfind("E"+s)', | 
					
						
							|  |  |  |        "late match, 100 characters", 100) | 
					
						
							|  |  |  | def rfind_test_slow_match_100_characters(STR): | 
					
						
							|  |  |  |     m = STR("ABC"*33) | 
					
						
							|  |  |  |     d = STR("D") | 
					
						
							|  |  |  |     e = STR("E") | 
					
						
							|  |  |  |     s1 = e+m + (d+m)*500 | 
					
						
							|  |  |  |     s2 = e+m | 
					
						
							|  |  |  |     s1_rfind = s1.rfind | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         s1_rfind(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s="ABC"*33; (s+"E"+("D"+s)*500).rfind(s+"E")', | 
					
						
							|  |  |  |        "late match, 100 characters", 100) | 
					
						
							|  |  |  | def rfind_test_slow_match_100_characters_bis(STR): | 
					
						
							|  |  |  |     m = STR("ABC"*33) | 
					
						
							|  |  |  |     d = STR("D") | 
					
						
							|  |  |  |     e = STR("E") | 
					
						
							|  |  |  |     s1 = m+e + (d+m)*500 | 
					
						
							|  |  |  |     s2 = m+e | 
					
						
							|  |  |  |     s1_rfind = s1.rfind | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         s1_rfind(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### Now with index. | 
					
						
							|  |  |  | # Skip the ones which fail because that would include exception overhead. | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).index("A")', "early match, single character", 1000) | 
					
						
							|  |  |  | def index_test_quick_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("A") | 
					
						
							|  |  |  |     s1_index = s1.index | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_index(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).index("AB")', "early match, two characters", 1000) | 
					
						
							|  |  |  | def index_test_quick_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("AB") | 
					
						
							|  |  |  |     s1_index = s1.index | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_index(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000) | 
					
						
							|  |  |  | def index_test_slow_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 300+"C") | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     s1_index = s1.index | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_index(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s="ABC"*33; ((s+"D")*500+s+"E").index(s+"E")', | 
					
						
							|  |  |  |        "late match, 100 characters", 100) | 
					
						
							|  |  |  | def index_test_slow_match_100_characters(STR): | 
					
						
							|  |  |  |     m = STR("ABC"*33) | 
					
						
							|  |  |  |     d = STR("D") | 
					
						
							|  |  |  |     e = STR("E") | 
					
						
							|  |  |  |     s1 = (m+d)*500 + m+e | 
					
						
							|  |  |  |     s2 = m+e | 
					
						
							|  |  |  |     s1_index = s1.index | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         s1_index(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### Same for rindex | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).rindex("A")', "early match, single character", 1000) | 
					
						
							|  |  |  | def rindex_test_quick_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("A") | 
					
						
							|  |  |  |     s1_rindex = s1.rindex | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rindex(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).rindex("AB")', "early match, two characters", 1000) | 
					
						
							|  |  |  | def rindex_test_quick_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("AB") | 
					
						
							|  |  |  |     s1_rindex = s1.rindex | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rindex(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("C"+"AB"*300).rindex("CA")', "late match, two characters", 1000) | 
					
						
							|  |  |  | def rindex_test_slow_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("C" + "AB" * 300) | 
					
						
							|  |  |  |     s2 = STR("CA") | 
					
						
							|  |  |  |     s1_rindex = s1.rindex | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rindex(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rindex("E"+s)', | 
					
						
							|  |  |  |        "late match, 100 characters", 100) | 
					
						
							|  |  |  | def rindex_test_slow_match_100_characters(STR): | 
					
						
							|  |  |  |     m = STR("ABC"*33) | 
					
						
							|  |  |  |     d = STR("D") | 
					
						
							|  |  |  |     e = STR("E") | 
					
						
							|  |  |  |     s1 = e + m + (d+m)*500 | 
					
						
							|  |  |  |     s2 = e + m | 
					
						
							|  |  |  |     s1_rindex = s1.rindex | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         s1_rindex(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### Same for partition | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).partition("A")', "early match, single character", 1000) | 
					
						
							|  |  |  | def partition_test_quick_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("A") | 
					
						
							|  |  |  |     s1_partition = s1.partition | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_partition(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).partition("B")', "no match, single character", 1000) | 
					
						
							|  |  |  | def partition_test_no_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("B") | 
					
						
							|  |  |  |     s1_partition = s1.partition | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_partition(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).partition("AB")', "early match, two characters", 1000) | 
					
						
							|  |  |  | def partition_test_quick_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("AB") | 
					
						
							|  |  |  |     s1_partition = s1.partition | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_partition(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).partition("BC")', "no match, two characters", 1000) | 
					
						
							|  |  |  | def partition_test_no_match_two_character(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     s1_partition = s1.partition | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_partition(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*300+"C").partition("BC")', "late match, two characters", 1000) | 
					
						
							|  |  |  | def partition_test_slow_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 300+"C") | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     s1_partition = s1.partition | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_partition(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s="ABC"*33; ((s+"D")*500+s+"E").partition(s+"E")', | 
					
						
							|  |  |  |        "late match, 100 characters", 100) | 
					
						
							|  |  |  | def partition_test_slow_match_100_characters(STR): | 
					
						
							|  |  |  |     m = STR("ABC"*33) | 
					
						
							|  |  |  |     d = STR("D") | 
					
						
							|  |  |  |     e = STR("E") | 
					
						
							|  |  |  |     s1 = (m+d)*500 + m+e | 
					
						
							|  |  |  |     s2 = m+e | 
					
						
							|  |  |  |     s1_partition = s1.partition | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         s1_partition(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### Same for rpartition | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).rpartition("A")', "early match, single character", 1000) | 
					
						
							|  |  |  | def rpartition_test_quick_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("A") | 
					
						
							|  |  |  |     s1_rpartition = s1.rpartition | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rpartition(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).rpartition("B")', "no match, single character", 1000) | 
					
						
							|  |  |  | def rpartition_test_no_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("B") | 
					
						
							|  |  |  |     s1_rpartition = s1.rpartition | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rpartition(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).rpartition("AB")', "early match, two characters", 1000) | 
					
						
							|  |  |  | def rpartition_test_quick_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("AB") | 
					
						
							|  |  |  |     s1_rpartition = s1.rpartition | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rpartition(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).rpartition("BC")', "no match, two characters", 1000) | 
					
						
							|  |  |  | def rpartition_test_no_match_two_character(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     s1_rpartition = s1.rpartition | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rpartition(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("C"+"AB"*300).rpartition("CA")', "late match, two characters", 1000) | 
					
						
							|  |  |  | def rpartition_test_slow_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("C" + "AB" * 300) | 
					
						
							|  |  |  |     s2 = STR("CA") | 
					
						
							|  |  |  |     s1_rpartition = s1.rpartition | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rpartition(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rpartition("E"+s)', | 
					
						
							|  |  |  |        "late match, 100 characters", 100) | 
					
						
							|  |  |  | def rpartition_test_slow_match_100_characters(STR): | 
					
						
							|  |  |  |     m = STR("ABC"*33) | 
					
						
							|  |  |  |     d = STR("D") | 
					
						
							|  |  |  |     e = STR("E") | 
					
						
							|  |  |  |     s1 = e + m + (d+m)*500 | 
					
						
							|  |  |  |     s2 = e + m | 
					
						
							|  |  |  |     s1_rpartition = s1.rpartition | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         s1_rpartition(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### Same for split(s, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).split("A", 1)', "early match, single character", 1000) | 
					
						
							|  |  |  | def split_test_quick_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("A") | 
					
						
							|  |  |  |     s1_split = s1.split | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_split(s2, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).split("B", 1)', "no match, single character", 1000) | 
					
						
							|  |  |  | def split_test_no_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("B") | 
					
						
							|  |  |  |     s1_split = s1.split | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_split(s2, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).split("AB", 1)', "early match, two characters", 1000) | 
					
						
							|  |  |  | def split_test_quick_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("AB") | 
					
						
							|  |  |  |     s1_split = s1.split | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_split(s2, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).split("BC", 1)', "no match, two characters", 1000) | 
					
						
							|  |  |  | def split_test_no_match_two_character(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     s1_split = s1.split | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_split(s2, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*300+"C").split("BC", 1)', "late match, two characters", 1000) | 
					
						
							|  |  |  | def split_test_slow_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 300+"C") | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     s1_split = s1.split | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_split(s2, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s="ABC"*33; ((s+"D")*500+s+"E").split(s+"E", 1)', | 
					
						
							|  |  |  |        "late match, 100 characters", 100) | 
					
						
							|  |  |  | def split_test_slow_match_100_characters(STR): | 
					
						
							|  |  |  |     m = STR("ABC"*33) | 
					
						
							|  |  |  |     d = STR("D") | 
					
						
							|  |  |  |     e = STR("E") | 
					
						
							|  |  |  |     s1 = (m+d)*500 + m+e | 
					
						
							|  |  |  |     s2 = m+e | 
					
						
							|  |  |  |     s1_split = s1.split | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         s1_split(s2, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### Same for rsplit(s, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).rsplit("A", 1)', "early match, single character", 1000) | 
					
						
							|  |  |  | def rsplit_test_quick_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("A") | 
					
						
							|  |  |  |     s1_rsplit = s1.rsplit | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rsplit(s2, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A"*1000).rsplit("B", 1)', "no match, single character", 1000) | 
					
						
							|  |  |  | def rsplit_test_no_match_single_character(STR): | 
					
						
							|  |  |  |     s1 = STR("A" * 1000) | 
					
						
							|  |  |  |     s2 = STR("B") | 
					
						
							|  |  |  |     s1_rsplit = s1.rsplit | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rsplit(s2, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).rsplit("AB", 1)', "early match, two characters", 1000) | 
					
						
							|  |  |  | def rsplit_test_quick_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("AB") | 
					
						
							|  |  |  |     s1_rsplit = s1.rsplit | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rsplit(s2, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("AB"*1000).rsplit("BC", 1)', "no match, two characters", 1000) | 
					
						
							|  |  |  | def rsplit_test_no_match_two_character(STR): | 
					
						
							|  |  |  |     s1 = STR("AB" * 1000) | 
					
						
							|  |  |  |     s2 = STR("BC") | 
					
						
							|  |  |  |     s1_rsplit = s1.rsplit | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rsplit(s2, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("C"+"AB"*300).rsplit("CA", 1)', "late match, two characters", 1000) | 
					
						
							|  |  |  | def rsplit_test_slow_match_two_characters(STR): | 
					
						
							|  |  |  |     s1 = STR("C" + "AB" * 300) | 
					
						
							|  |  |  |     s2 = STR("CA") | 
					
						
							|  |  |  |     s1_rsplit = s1.rsplit | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_rsplit(s2, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rsplit("E"+s, 1)', | 
					
						
							|  |  |  |        "late match, 100 characters", 100) | 
					
						
							|  |  |  | def rsplit_test_slow_match_100_characters(STR): | 
					
						
							|  |  |  |     m = STR("ABC"*33) | 
					
						
							|  |  |  |     d = STR("D") | 
					
						
							|  |  |  |     e = STR("E") | 
					
						
							|  |  |  |     s1 = e + m + (d+m)*500 | 
					
						
							|  |  |  |     s2 = e + m | 
					
						
							|  |  |  |     s1_rsplit = s1.rsplit | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         s1_rsplit(s2, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### Benchmark the operator-based methods | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"A"*10', "repeat 1 character 10 times", 1000) | 
					
						
							|  |  |  | def repeat_single_10_times(STR): | 
					
						
							|  |  |  |     s = STR("A") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s * 10 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"A"*1000', "repeat 1 character 1000 times", 1000) | 
					
						
							|  |  |  | def repeat_single_1000_times(STR): | 
					
						
							|  |  |  |     s = STR("A") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s * 1000 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000) | 
					
						
							|  |  |  | def repeat_5_10_times(STR): | 
					
						
							|  |  |  |     s = STR("ABCDE") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s * 10 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000) | 
					
						
							|  |  |  | def repeat_5_1000_times(STR): | 
					
						
							|  |  |  |     s = STR("ABCDE") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s * 1000 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | # + for concat | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"Andrew"+"Dalke"', "concat two strings", 1000) | 
					
						
							|  |  |  | def concat_two_strings(STR): | 
					
						
							|  |  |  |     s1 = STR("Andrew") | 
					
						
							|  |  |  |     s2 = STR("Dalke") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1+s2 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15", | 
					
						
							|  |  |  |        1000) | 
					
						
							|  |  |  | def concat_many_strings(STR): | 
					
						
							|  |  |  |     s1=STR('TIXSGYNREDCVBHJ') | 
					
						
							|  |  |  |     s2=STR('PUMTLXBZVDO') | 
					
						
							|  |  |  |     s3=STR('FVZNJ') | 
					
						
							|  |  |  |     s4=STR('OGDXUW') | 
					
						
							|  |  |  |     s5=STR('WEIMRNCOYVGHKB') | 
					
						
							|  |  |  |     s6=STR('FCQTNMXPUZH') | 
					
						
							|  |  |  |     s7=STR('TICZJYRLBNVUEAK') | 
					
						
							|  |  |  |     s8=STR('REYB') | 
					
						
							|  |  |  |     s9=STR('PWUOQ') | 
					
						
							|  |  |  |     s10=STR('EQHCMKBS') | 
					
						
							|  |  |  |     s11=STR('AEVDFOH') | 
					
						
							|  |  |  |     s12=STR('IFHVD') | 
					
						
							|  |  |  |     s13=STR('JGTCNLXWOHQ') | 
					
						
							|  |  |  |     s14=STR('ITSKEPYLROZAWXF') | 
					
						
							|  |  |  |     s15=STR('THEK') | 
					
						
							|  |  |  |     s16=STR('GHPZFBUYCKMNJIT') | 
					
						
							|  |  |  |     s17=STR('JMUZ') | 
					
						
							|  |  |  |     s18=STR('WLZQMTB') | 
					
						
							|  |  |  |     s19=STR('KPADCBW') | 
					
						
							|  |  |  |     s20=STR('TNJHZQAGBU') | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         (s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+ | 
					
						
							|  |  |  |          s11+s12+s13+s14+s15+s16+s17+s18+s19+s20) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### Benchmark join | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | def get_bytes_yielding_seq(STR, arg): | 
					
						
							|  |  |  |     if STR is BYTES and sys.version_info >= (3,): | 
					
						
							|  |  |  |         raise UnsupportedType | 
					
						
							|  |  |  |     return STR(arg) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"A".join("")', | 
					
						
							|  |  |  |        "join empty string, with 1 character sep", 100) | 
					
						
							|  |  |  | def join_empty_single(STR): | 
					
						
							|  |  |  |     sep = STR("A") | 
					
						
							|  |  |  |     s2 = get_bytes_yielding_seq(STR, "") | 
					
						
							|  |  |  |     sep_join = sep.join | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         sep_join(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"ABCDE".join("")', | 
					
						
							|  |  |  |        "join empty string, with 5 character sep", 100) | 
					
						
							|  |  |  | def join_empty_5(STR): | 
					
						
							|  |  |  |     sep = STR("ABCDE") | 
					
						
							|  |  |  |     s2 = get_bytes_yielding_seq(STR, "") | 
					
						
							|  |  |  |     sep_join = sep.join | 
					
						
							|  |  |  |     for x in _RANGE_100: | 
					
						
							|  |  |  |         sep_join(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"A".join("ABC..Z")', | 
					
						
							|  |  |  |        "join string with 26 characters, with 1 character sep", 1000) | 
					
						
							|  |  |  | def join_alphabet_single(STR): | 
					
						
							|  |  |  |     sep = STR("A") | 
					
						
							|  |  |  |     s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ") | 
					
						
							|  |  |  |     sep_join = sep.join | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         sep_join(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"ABCDE".join("ABC..Z")', | 
					
						
							|  |  |  |        "join string with 26 characters, with 5 character sep", 1000) | 
					
						
							|  |  |  | def join_alphabet_5(STR): | 
					
						
							|  |  |  |     sep = STR("ABCDE") | 
					
						
							|  |  |  |     s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ") | 
					
						
							|  |  |  |     sep_join = sep.join | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         sep_join(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"A".join(list("ABC..Z"))', | 
					
						
							|  |  |  |        "join list of 26 characters, with 1 character sep", 1000) | 
					
						
							|  |  |  | def join_alphabet_list_single(STR): | 
					
						
							|  |  |  |     sep = STR("A") | 
					
						
							|  |  |  |     s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"] | 
					
						
							|  |  |  |     sep_join = sep.join | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         sep_join(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"ABCDE".join(list("ABC..Z"))', | 
					
						
							|  |  |  |        "join list of 26 characters, with 5 character sep", 1000) | 
					
						
							|  |  |  | def join_alphabet_list_five(STR): | 
					
						
							|  |  |  |     sep = STR("ABCDE") | 
					
						
							|  |  |  |     s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"] | 
					
						
							|  |  |  |     sep_join = sep.join | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         sep_join(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"A".join(["Bob"]*100))', | 
					
						
							|  |  |  |        "join list of 100 words, with 1 character sep", 1000) | 
					
						
							|  |  |  | def join_100_words_single(STR): | 
					
						
							|  |  |  |     sep = STR("A") | 
					
						
							|  |  |  |     s2 = [STR("Bob")]*100 | 
					
						
							|  |  |  |     sep_join = sep.join | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         sep_join(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"ABCDE".join(["Bob"]*100))', | 
					
						
							|  |  |  |        "join list of 100 words, with 5 character sep", 1000) | 
					
						
							|  |  |  | def join_100_words_5(STR): | 
					
						
							|  |  |  |     sep = STR("ABCDE") | 
					
						
							|  |  |  |     s2 = [STR("Bob")]*100 | 
					
						
							|  |  |  |     sep_join = sep.join | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         sep_join(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### split tests | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000) | 
					
						
							|  |  |  | def whitespace_split(STR): | 
					
						
							|  |  |  |     s = STR("Here are some words. "*2) | 
					
						
							|  |  |  |     s_split = s.split | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_split() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000) | 
					
						
							|  |  |  | def whitespace_rsplit(STR): | 
					
						
							|  |  |  |     s = STR("Here are some words. "*2) | 
					
						
							|  |  |  |     s_rsplit = s.rsplit | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_rsplit() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("Here are some words. "*2).split(None, 1)', | 
					
						
							|  |  |  |        "split 1 whitespace", 1000) | 
					
						
							|  |  |  | def whitespace_split_1(STR): | 
					
						
							|  |  |  |     s = STR("Here are some words. "*2) | 
					
						
							|  |  |  |     s_split = s.split | 
					
						
							|  |  |  |     N = None | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_split(N, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("Here are some words. "*2).rsplit(None, 1)', | 
					
						
							|  |  |  |        "split 1 whitespace", 1000) | 
					
						
							|  |  |  | def whitespace_rsplit_1(STR): | 
					
						
							|  |  |  |     s = STR("Here are some words. "*2) | 
					
						
							|  |  |  |     s_rsplit = s.rsplit | 
					
						
							|  |  |  |     N = None | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_rsplit(N, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("Here are some words. "*2).partition(" ")', | 
					
						
							|  |  |  |        "split 1 whitespace", 1000) | 
					
						
							|  |  |  | def whitespace_partition(STR): | 
					
						
							|  |  |  |     sep = STR(" ") | 
					
						
							|  |  |  |     s = STR("Here are some words. "*2) | 
					
						
							|  |  |  |     s_partition = s.partition | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_partition(sep) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("Here are some words. "*2).rpartition(" ")', | 
					
						
							|  |  |  |        "split 1 whitespace", 1000) | 
					
						
							|  |  |  | def whitespace_rpartition(STR): | 
					
						
							|  |  |  |     sep = STR(" ") | 
					
						
							|  |  |  |     s = STR("Here are some words. "*2) | 
					
						
							|  |  |  |     s_rpartition = s.rpartition | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_rpartition(sep) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | human_text = """\
 | 
					
						
							|  |  |  | Python is a dynamic object-oriented programming language that can be | 
					
						
							|  |  |  | used for many kinds of software development. It offers strong support | 
					
						
							|  |  |  | for integration with other languages and tools, comes with extensive | 
					
						
							|  |  |  | standard libraries, and can be learned in a few days. Many Python | 
					
						
							|  |  |  | programmers report substantial productivity gains and feel the language | 
					
						
							|  |  |  | encourages the development of higher quality, more maintainable code. | 
					
						
							|  |  |  | 
 | 
					
						
							| 
									
										
										
										
											2012-10-05 02:48:46 +02:00
										 |  |  | Python runs on Windows, Linux/Unix, Mac OS X, Amiga, Palm | 
					
						
							| 
									
										
										
										
											2012-04-09 17:03:32 +02:00
										 |  |  | Handhelds, and Nokia mobile phones. Python has also been ported to the | 
					
						
							|  |  |  | Java and .NET virtual machines. | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | Python is distributed under an OSI-approved open source license that | 
					
						
							|  |  |  | makes it free to use, even for commercial products. | 
					
						
							|  |  |  | """*25
 | 
					
						
							|  |  |  | human_text_bytes = bytes_from_str(human_text) | 
					
						
							|  |  |  | human_text_unicode = unicode_from_str(human_text) | 
					
						
							|  |  |  | def _get_human_text(STR): | 
					
						
							|  |  |  |     if STR is UNICODE: | 
					
						
							|  |  |  |         return human_text_unicode | 
					
						
							|  |  |  |     if STR is BYTES: | 
					
						
							|  |  |  |         return human_text_bytes | 
					
						
							|  |  |  |     raise AssertionError | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('human_text.split()', "split whitespace (huge)", 10) | 
					
						
							|  |  |  | def whitespace_split_huge(STR): | 
					
						
							|  |  |  |     s = _get_human_text(STR) | 
					
						
							|  |  |  |     s_split = s.split | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         s_split() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('human_text.rsplit()', "split whitespace (huge)", 10) | 
					
						
							|  |  |  | def whitespace_rsplit_huge(STR): | 
					
						
							|  |  |  |     s = _get_human_text(STR) | 
					
						
							|  |  |  |     s_rsplit = s.rsplit | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         s_rsplit() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000) | 
					
						
							|  |  |  | def newlines_split(STR): | 
					
						
							|  |  |  |     s = STR("this\nis\na\ntest\n") | 
					
						
							|  |  |  |     s_split = s.split | 
					
						
							|  |  |  |     nl = STR("\n") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_split(nl) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000) | 
					
						
							|  |  |  | def newlines_rsplit(STR): | 
					
						
							|  |  |  |     s = STR("this\nis\na\ntest\n") | 
					
						
							|  |  |  |     s_rsplit = s.rsplit | 
					
						
							|  |  |  |     nl = STR("\n") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_rsplit(nl) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000) | 
					
						
							|  |  |  | def newlines_splitlines(STR): | 
					
						
							|  |  |  |     s = STR("this\nis\na\ntest\n") | 
					
						
							|  |  |  |     s_splitlines = s.splitlines | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_splitlines() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | ## split text with 2000 newlines | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | def _make_2000_lines(): | 
					
						
							|  |  |  |     import random | 
					
						
							|  |  |  |     r = random.Random(100) | 
					
						
							|  |  |  |     chars = list(map(chr, range(32, 128))) | 
					
						
							|  |  |  |     i = 0 | 
					
						
							|  |  |  |     while i < len(chars): | 
					
						
							|  |  |  |         chars[i] = " " | 
					
						
							|  |  |  |         i += r.randrange(9) | 
					
						
							|  |  |  |     s = "".join(chars) | 
					
						
							|  |  |  |     s = s*4 | 
					
						
							|  |  |  |     words = [] | 
					
						
							|  |  |  |     for i in range(2000): | 
					
						
							|  |  |  |         start = r.randrange(96) | 
					
						
							|  |  |  |         n = r.randint(5, 65) | 
					
						
							|  |  |  |         words.append(s[start:start+n]) | 
					
						
							|  |  |  |     return "\n".join(words)+"\n" | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | _text_with_2000_lines = _make_2000_lines() | 
					
						
							|  |  |  | _text_with_2000_lines_bytes = bytes_from_str(_text_with_2000_lines) | 
					
						
							|  |  |  | _text_with_2000_lines_unicode = unicode_from_str(_text_with_2000_lines) | 
					
						
							|  |  |  | def _get_2000_lines(STR): | 
					
						
							|  |  |  |     if STR is UNICODE: | 
					
						
							|  |  |  |         return _text_with_2000_lines_unicode | 
					
						
							|  |  |  |     if STR is BYTES: | 
					
						
							|  |  |  |         return _text_with_2000_lines_bytes | 
					
						
							|  |  |  |     raise AssertionError | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"...text...".split("\\n")', "split 2000 newlines", 10) | 
					
						
							|  |  |  | def newlines_split_2000(STR): | 
					
						
							|  |  |  |     s = _get_2000_lines(STR) | 
					
						
							|  |  |  |     s_split = s.split | 
					
						
							|  |  |  |     nl = STR("\n") | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         s_split(nl) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10) | 
					
						
							|  |  |  | def newlines_rsplit_2000(STR): | 
					
						
							|  |  |  |     s = _get_2000_lines(STR) | 
					
						
							|  |  |  |     s_rsplit = s.rsplit | 
					
						
							|  |  |  |     nl = STR("\n") | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         s_rsplit(nl) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"...text...".splitlines()', "split 2000 newlines", 10) | 
					
						
							|  |  |  | def newlines_splitlines_2000(STR): | 
					
						
							|  |  |  |     s = _get_2000_lines(STR) | 
					
						
							|  |  |  |     s_splitlines = s.splitlines | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         s_splitlines() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | ## split text on "--" characters | 
					
						
							|  |  |  | @bench( | 
					
						
							|  |  |  |     '"this--is--a--test--of--the--emergency--broadcast--system".split("--")', | 
					
						
							|  |  |  |     "split on multicharacter separator (small)", 1000) | 
					
						
							|  |  |  | def split_multichar_sep_small(STR): | 
					
						
							|  |  |  |     s = STR("this--is--a--test--of--the--emergency--broadcast--system") | 
					
						
							|  |  |  |     s_split = s.split | 
					
						
							|  |  |  |     pat = STR("--") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_split(pat) | 
					
						
							|  |  |  | @bench( | 
					
						
							|  |  |  |     '"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")', | 
					
						
							|  |  |  |     "split on multicharacter separator (small)", 1000) | 
					
						
							|  |  |  | def rsplit_multichar_sep_small(STR): | 
					
						
							|  |  |  |     s = STR("this--is--a--test--of--the--emergency--broadcast--system") | 
					
						
							|  |  |  |     s_rsplit = s.rsplit | 
					
						
							|  |  |  |     pat = STR("--") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_rsplit(pat) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | ## split dna text on "ACTAT" characters | 
					
						
							|  |  |  | @bench('dna.split("ACTAT")', | 
					
						
							|  |  |  |        "split on multicharacter separator (dna)", 10) | 
					
						
							|  |  |  | def split_multichar_sep_dna(STR): | 
					
						
							|  |  |  |     s = _get_dna(STR) | 
					
						
							|  |  |  |     s_split = s.split | 
					
						
							|  |  |  |     pat = STR("ACTAT") | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         s_split(pat) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('dna.rsplit("ACTAT")', | 
					
						
							|  |  |  |        "split on multicharacter separator (dna)", 10) | 
					
						
							|  |  |  | def rsplit_multichar_sep_dna(STR): | 
					
						
							|  |  |  |     s = _get_dna(STR) | 
					
						
							|  |  |  |     s_rsplit = s.rsplit | 
					
						
							|  |  |  |     pat = STR("ACTAT") | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         s_rsplit(pat) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | ## split with limits | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | GFF3_example = "\t".join([ | 
					
						
							|  |  |  |     "I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".", | 
					
						
							|  |  |  |     "ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"]) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('GFF3_example.split("\\t")', "tab split", 1000) | 
					
						
							|  |  |  | def tab_split_no_limit(STR): | 
					
						
							|  |  |  |     sep = STR("\t") | 
					
						
							|  |  |  |     s = STR(GFF3_example) | 
					
						
							|  |  |  |     s_split = s.split | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_split(sep) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('GFF3_example.split("\\t", 8)', "tab split", 1000) | 
					
						
							|  |  |  | def tab_split_limit(STR): | 
					
						
							|  |  |  |     sep = STR("\t") | 
					
						
							|  |  |  |     s = STR(GFF3_example) | 
					
						
							|  |  |  |     s_split = s.split | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_split(sep, 8) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('GFF3_example.rsplit("\\t")', "tab split", 1000) | 
					
						
							|  |  |  | def tab_rsplit_no_limit(STR): | 
					
						
							|  |  |  |     sep = STR("\t") | 
					
						
							|  |  |  |     s = STR(GFF3_example) | 
					
						
							|  |  |  |     s_rsplit = s.rsplit | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_rsplit(sep) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000) | 
					
						
							|  |  |  | def tab_rsplit_limit(STR): | 
					
						
							|  |  |  |     sep = STR("\t") | 
					
						
							|  |  |  |     s = STR(GFF3_example) | 
					
						
							|  |  |  |     s_rsplit = s.rsplit | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_rsplit(sep, 8) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### Count characters | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('...text.with.2000.newlines.count("\\n")', | 
					
						
							|  |  |  |        "count newlines", 10) | 
					
						
							|  |  |  | def count_newlines(STR): | 
					
						
							|  |  |  |     s = _get_2000_lines(STR) | 
					
						
							|  |  |  |     s_count = s.count | 
					
						
							|  |  |  |     nl = STR("\n") | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         s_count(nl) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | # Orchid sequences concatenated, from Biopython | 
					
						
							|  |  |  | _dna = """
 | 
					
						
							|  |  |  | CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT | 
					
						
							|  |  |  | AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG | 
					
						
							|  |  |  | AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT | 
					
						
							|  |  |  | TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC | 
					
						
							|  |  |  | AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG | 
					
						
							|  |  |  | TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT | 
					
						
							|  |  |  | CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT | 
					
						
							|  |  |  | TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT | 
					
						
							|  |  |  | GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC | 
					
						
							|  |  |  | TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG | 
					
						
							|  |  |  | GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA | 
					
						
							|  |  |  | ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC | 
					
						
							|  |  |  | CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA | 
					
						
							|  |  |  | ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA | 
					
						
							|  |  |  | ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA | 
					
						
							|  |  |  | TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG | 
					
						
							|  |  |  | CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG | 
					
						
							|  |  |  | GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA | 
					
						
							|  |  |  | ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG | 
					
						
							|  |  |  | ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC | 
					
						
							|  |  |  | ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA | 
					
						
							|  |  |  | GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA | 
					
						
							|  |  |  | TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG | 
					
						
							|  |  |  | TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT | 
					
						
							|  |  |  | TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG | 
					
						
							|  |  |  | GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG | 
					
						
							|  |  |  | GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT | 
					
						
							|  |  |  | AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC | 
					
						
							|  |  |  | GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG | 
					
						
							|  |  |  | TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT | 
					
						
							|  |  |  | CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA | 
					
						
							|  |  |  | TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC | 
					
						
							|  |  |  | TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC | 
					
						
							|  |  |  | AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT | 
					
						
							|  |  |  | GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT | 
					
						
							|  |  |  | GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA | 
					
						
							|  |  |  | CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG | 
					
						
							|  |  |  | GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA | 
					
						
							|  |  |  | TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG | 
					
						
							|  |  |  | ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT | 
					
						
							|  |  |  | GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA | 
					
						
							|  |  |  | AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC | 
					
						
							|  |  |  | AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA | 
					
						
							|  |  |  | ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC | 
					
						
							|  |  |  | GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC | 
					
						
							|  |  |  | GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC | 
					
						
							|  |  |  | AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA | 
					
						
							|  |  |  | GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG | 
					
						
							|  |  |  | ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC | 
					
						
							|  |  |  | GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC | 
					
						
							|  |  |  | """
 | 
					
						
							|  |  |  | _dna = "".join(_dna.splitlines()) | 
					
						
							|  |  |  | _dna = _dna * 25 | 
					
						
							|  |  |  | _dna_bytes = bytes_from_str(_dna) | 
					
						
							|  |  |  | _dna_unicode = unicode_from_str(_dna) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | def _get_dna(STR): | 
					
						
							|  |  |  |     if STR is UNICODE: | 
					
						
							|  |  |  |         return _dna_unicode | 
					
						
							|  |  |  |     if STR is BYTES: | 
					
						
							|  |  |  |         return _dna_bytes | 
					
						
							|  |  |  |     raise AssertionError | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('dna.count("AACT")', "count AACT substrings in DNA example", 10) | 
					
						
							|  |  |  | def count_aact(STR): | 
					
						
							|  |  |  |     seq = _get_dna(STR) | 
					
						
							|  |  |  |     seq_count = seq.count | 
					
						
							|  |  |  |     needle = STR("AACT") | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         seq_count(needle) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | ##### startswith and endswith | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"Andrew".startswith("A")', 'startswith single character', 1000) | 
					
						
							|  |  |  | def startswith_single(STR): | 
					
						
							|  |  |  |     s1 = STR("Andrew") | 
					
						
							|  |  |  |     s2 = STR("A") | 
					
						
							|  |  |  |     s1_startswith = s1.startswith | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_startswith(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"Andrew".startswith("Andrew")', 'startswith multiple characters', | 
					
						
							|  |  |  |        1000) | 
					
						
							|  |  |  | def startswith_multiple(STR): | 
					
						
							|  |  |  |     s1 = STR("Andrew") | 
					
						
							|  |  |  |     s2 = STR("Andrew") | 
					
						
							|  |  |  |     s1_startswith = s1.startswith | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_startswith(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"Andrew".startswith("Anders")', | 
					
						
							|  |  |  |        'startswith multiple characters - not!', 1000) | 
					
						
							|  |  |  | def startswith_multiple_not(STR): | 
					
						
							|  |  |  |     s1 = STR("Andrew") | 
					
						
							|  |  |  |     s2 = STR("Anders") | 
					
						
							|  |  |  |     s1_startswith = s1.startswith | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_startswith(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | # endswith | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"Andrew".endswith("w")', 'endswith single character', 1000) | 
					
						
							|  |  |  | def endswith_single(STR): | 
					
						
							|  |  |  |     s1 = STR("Andrew") | 
					
						
							|  |  |  |     s2 = STR("w") | 
					
						
							|  |  |  |     s1_endswith = s1.endswith | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_endswith(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000) | 
					
						
							|  |  |  | def endswith_multiple(STR): | 
					
						
							|  |  |  |     s1 = STR("Andrew") | 
					
						
							|  |  |  |     s2 = STR("Andrew") | 
					
						
							|  |  |  |     s1_endswith = s1.endswith | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_endswith(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"Andrew".endswith("Anders")', | 
					
						
							|  |  |  |        'endswith multiple characters - not!', 1000) | 
					
						
							|  |  |  | def endswith_multiple_not(STR): | 
					
						
							|  |  |  |     s1 = STR("Andrew") | 
					
						
							|  |  |  |     s2 = STR("Anders") | 
					
						
							|  |  |  |     s1_endswith = s1.endswith | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s1_endswith(s2) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### Strip | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"Hello!\\n".strip()', 'strip terminal newline', 1000) | 
					
						
							|  |  |  | def terminal_newline_strip_right(STR): | 
					
						
							|  |  |  |     s = STR("Hello!\n") | 
					
						
							|  |  |  |     s_strip = s.strip | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_strip() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000) | 
					
						
							|  |  |  | def terminal_newline_rstrip(STR): | 
					
						
							|  |  |  |     s = STR("Hello!\n") | 
					
						
							|  |  |  |     s_rstrip = s.rstrip | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_rstrip() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"\\nHello!".strip()', 'strip terminal newline', 1000) | 
					
						
							|  |  |  | def terminal_newline_strip_left(STR): | 
					
						
							|  |  |  |     s = STR("\nHello!") | 
					
						
							|  |  |  |     s_strip = s.strip | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_strip() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000) | 
					
						
							|  |  |  | def terminal_newline_strip_both(STR): | 
					
						
							|  |  |  |     s = STR("\nHello!\n") | 
					
						
							|  |  |  |     s_strip = s.strip | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_strip() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000) | 
					
						
							|  |  |  | def terminal_newline_lstrip(STR): | 
					
						
							|  |  |  |     s = STR("\nHello!") | 
					
						
							|  |  |  |     s_lstrip = s.lstrip | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_lstrip() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('s="Hello!\\n"; s[:-1] if s[-1]=="\\n" else s', | 
					
						
							|  |  |  |        'strip terminal newline', 1000) | 
					
						
							|  |  |  | def terminal_newline_if_else(STR): | 
					
						
							|  |  |  |     s = STR("Hello!\n") | 
					
						
							|  |  |  |     NL = STR("\n") | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s[:-1] if (s[-1] == NL) else s | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | # Strip multiple spaces or tabs | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"Hello\\t   \\t".strip()', 'strip terminal spaces and tabs', 1000) | 
					
						
							|  |  |  | def terminal_space_strip(STR): | 
					
						
							|  |  |  |     s = STR("Hello\t   \t!") | 
					
						
							|  |  |  |     s_strip = s.strip | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_strip() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"Hello\\t   \\t".rstrip()', 'strip terminal spaces and tabs', 1000) | 
					
						
							|  |  |  | def terminal_space_rstrip(STR): | 
					
						
							|  |  |  |     s = STR("Hello!\t   \t") | 
					
						
							|  |  |  |     s_rstrip = s.rstrip | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_rstrip() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"\\t   \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000) | 
					
						
							|  |  |  | def terminal_space_lstrip(STR): | 
					
						
							|  |  |  |     s = STR("\t   \tHello!") | 
					
						
							|  |  |  |     s_lstrip = s.lstrip | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_lstrip() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### replace | 
					
						
							|  |  |  | @bench('"This is a test".replace(" ", "\\t")', 'replace single character', | 
					
						
							|  |  |  |        1000) | 
					
						
							|  |  |  | def replace_single_character(STR): | 
					
						
							|  |  |  |     s = STR("This is a test!") | 
					
						
							|  |  |  |     from_str = STR(" ") | 
					
						
							|  |  |  |     to_str = STR("\t") | 
					
						
							|  |  |  |     s_replace = s.replace | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_replace(from_str, to_str) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @uses_re | 
					
						
							|  |  |  | @bench('re.sub(" ", "\\t", "This is a test"', 'replace single character', | 
					
						
							|  |  |  |        1000) | 
					
						
							|  |  |  | def replace_single_character_re(STR): | 
					
						
							|  |  |  |     s = STR("This is a test!") | 
					
						
							|  |  |  |     pat = re.compile(STR(" ")) | 
					
						
							|  |  |  |     to_str = STR("\t") | 
					
						
							|  |  |  |     pat_sub = pat.sub | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         pat_sub(to_str, s) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('"...text.with.2000.lines...replace("\\n", " ")', | 
					
						
							|  |  |  |        'replace single character, big string', 10) | 
					
						
							|  |  |  | def replace_single_character_big(STR): | 
					
						
							|  |  |  |     s = _get_2000_lines(STR) | 
					
						
							|  |  |  |     from_str = STR("\n") | 
					
						
							|  |  |  |     to_str = STR(" ") | 
					
						
							|  |  |  |     s_replace = s.replace | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         s_replace(from_str, to_str) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @uses_re | 
					
						
							|  |  |  | @bench('re.sub("\\n", " ", "...text.with.2000.lines...")', | 
					
						
							|  |  |  |        'replace single character, big string', 10) | 
					
						
							|  |  |  | def replace_single_character_big_re(STR): | 
					
						
							|  |  |  |     s = _get_2000_lines(STR) | 
					
						
							|  |  |  |     pat = re.compile(STR("\n")) | 
					
						
							|  |  |  |     to_str = STR(" ") | 
					
						
							|  |  |  |     pat_sub = pat.sub | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         pat_sub(to_str, s) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('dna.replace("ATC", "ATT")', | 
					
						
							|  |  |  |        'replace multiple characters, dna', 10) | 
					
						
							|  |  |  | def replace_multiple_characters_dna(STR): | 
					
						
							|  |  |  |     seq = _get_dna(STR) | 
					
						
							|  |  |  |     from_str = STR("ATC") | 
					
						
							|  |  |  |     to_str = STR("ATT") | 
					
						
							|  |  |  |     seq_replace = seq.replace | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         seq_replace(from_str, to_str) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | # This increases the character count | 
					
						
							|  |  |  | @bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")', | 
					
						
							|  |  |  |        'replace and expand multiple characters, big string', 10) | 
					
						
							|  |  |  | def replace_multiple_character_big(STR): | 
					
						
							|  |  |  |     s = _get_2000_lines(STR) | 
					
						
							|  |  |  |     from_str = STR("\n") | 
					
						
							|  |  |  |     to_str = STR("\r\n") | 
					
						
							|  |  |  |     s_replace = s.replace | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         s_replace(from_str, to_str) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | # This decreases the character count | 
					
						
							|  |  |  | @bench('"When shall we three meet again?".replace("ee", "")', | 
					
						
							|  |  |  |        'replace/remove multiple characters', 1000) | 
					
						
							|  |  |  | def replace_multiple_character_remove(STR): | 
					
						
							|  |  |  |     s = STR("When shall we three meet again?") | 
					
						
							|  |  |  |     from_str = STR("ee") | 
					
						
							|  |  |  |     to_str = STR("") | 
					
						
							|  |  |  |     s_replace = s.replace | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_replace(from_str, to_str) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | big_s = "A" + ("Z"*128*1024) | 
					
						
							|  |  |  | big_s_bytes = bytes_from_str(big_s) | 
					
						
							|  |  |  | big_s_unicode = unicode_from_str(big_s) | 
					
						
							|  |  |  | def _get_big_s(STR): | 
					
						
							|  |  |  |     if STR is UNICODE: return big_s_unicode | 
					
						
							|  |  |  |     if STR is BYTES: return big_s_bytes | 
					
						
							|  |  |  |     raise AssertionError | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | # The older replace implementation counted all matches in | 
					
						
							| 
									
										
										
										
											2013-08-26 01:32:56 +03:00
										 |  |  | # the string even when it only needed to make one replacement. | 
					
						
							| 
									
										
										
										
											2012-04-09 17:03:32 +02:00
										 |  |  | @bench('("A" + ("Z"*128*1024)).replace("A", "BB", 1)', | 
					
						
							|  |  |  |        'quick replace single character match', 10) | 
					
						
							|  |  |  | def quick_replace_single_match(STR): | 
					
						
							|  |  |  |     s = _get_big_s(STR) | 
					
						
							|  |  |  |     from_str = STR("A") | 
					
						
							|  |  |  |     to_str = STR("BB") | 
					
						
							|  |  |  |     s_replace = s.replace | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         s_replace(from_str, to_str, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("A" + ("Z"*128*1024)).replace("AZZ", "BBZZ", 1)', | 
					
						
							|  |  |  |        'quick replace multiple character match', 10) | 
					
						
							|  |  |  | def quick_replace_multiple_match(STR): | 
					
						
							|  |  |  |     s = _get_big_s(STR) | 
					
						
							|  |  |  |     from_str = STR("AZZ") | 
					
						
							|  |  |  |     to_str = STR("BBZZ") | 
					
						
							|  |  |  |     s_replace = s.replace | 
					
						
							|  |  |  |     for x in _RANGE_10: | 
					
						
							|  |  |  |         s_replace(from_str, to_str, 1) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | # CCP does a lot of this, for internationalisation of ingame messages. | 
					
						
							|  |  |  | _format = "The %(thing)s is %(place)s the %(location)s." | 
					
						
							|  |  |  | _format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", } | 
					
						
							|  |  |  | _format_bytes = bytes_from_str(_format) | 
					
						
							|  |  |  | _format_unicode = unicode_from_str(_format) | 
					
						
							|  |  |  | _format_dict_bytes = dict((bytes_from_str(k), bytes_from_str(v)) for (k,v) in _format_dict.items()) | 
					
						
							|  |  |  | _format_dict_unicode = dict((unicode_from_str(k), unicode_from_str(v)) for (k,v) in _format_dict.items()) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | def _get_format(STR): | 
					
						
							|  |  |  |     if STR is UNICODE: | 
					
						
							|  |  |  |         return _format_unicode | 
					
						
							|  |  |  |     if STR is BYTES: | 
					
						
							|  |  |  |         if sys.version_info >= (3,): | 
					
						
							|  |  |  |             raise UnsupportedType | 
					
						
							|  |  |  |         return _format_bytes | 
					
						
							|  |  |  |     raise AssertionError | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | def _get_format_dict(STR): | 
					
						
							|  |  |  |     if STR is UNICODE: | 
					
						
							|  |  |  |         return _format_dict_unicode | 
					
						
							|  |  |  |     if STR is BYTES: | 
					
						
							|  |  |  |         if sys.version_info >= (3,): | 
					
						
							|  |  |  |             raise UnsupportedType | 
					
						
							|  |  |  |         return _format_dict_bytes | 
					
						
							|  |  |  |     raise AssertionError | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | # Formatting. | 
					
						
							|  |  |  | @bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}', | 
					
						
							|  |  |  |        'formatting a string type with a dict', 1000) | 
					
						
							|  |  |  | def format_with_dict(STR): | 
					
						
							|  |  |  |     s = _get_format(STR) | 
					
						
							|  |  |  |     d = _get_format_dict(STR) | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s % d | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | #### Upper- and lower- case conversion | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("Where in the world is Carmen San Deigo?"*10).lower()', | 
					
						
							|  |  |  |        "case conversion -- rare", 1000) | 
					
						
							|  |  |  | def lower_conversion_rare(STR): | 
					
						
							|  |  |  |     s = STR("Where in the world is Carmen San Deigo?"*10) | 
					
						
							|  |  |  |     s_lower = s.lower | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_lower() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()', | 
					
						
							|  |  |  |        "case conversion -- dense", 1000) | 
					
						
							|  |  |  | def lower_conversion_dense(STR): | 
					
						
							|  |  |  |     s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10) | 
					
						
							|  |  |  |     s_lower = s.lower | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_lower() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()', | 
					
						
							|  |  |  |        "case conversion -- rare", 1000) | 
					
						
							|  |  |  | def upper_conversion_rare(STR): | 
					
						
							|  |  |  |     s = STR("Where in the world is Carmen San Deigo?"*10) | 
					
						
							|  |  |  |     s_upper = s.upper | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_upper() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | @bench('("where in the world is carmen san deigo?"*10).upper()', | 
					
						
							|  |  |  |        "case conversion -- dense", 1000) | 
					
						
							|  |  |  | def upper_conversion_dense(STR): | 
					
						
							|  |  |  |     s = STR("where in the world is carmen san deigo?"*10) | 
					
						
							|  |  |  |     s_upper = s.upper | 
					
						
							|  |  |  |     for x in _RANGE_1000: | 
					
						
							|  |  |  |         s_upper() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | # end of benchmarks | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | ################# | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | class BenchTimer(timeit.Timer): | 
					
						
							|  |  |  |     def best(self, repeat=1): | 
					
						
							|  |  |  |         for i in range(1, 10): | 
					
						
							|  |  |  |             number = 10**i | 
					
						
							|  |  |  |             x = self.timeit(number) | 
					
						
							|  |  |  |             if x > 0.02: | 
					
						
							|  |  |  |                 break | 
					
						
							|  |  |  |         times = [x] | 
					
						
							|  |  |  |         for i in range(1, repeat): | 
					
						
							|  |  |  |             times.append(self.timeit(number)) | 
					
						
							|  |  |  |         return min(times) / number | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | def main(): | 
					
						
							|  |  |  |     (options, test_names) = parser.parse_args() | 
					
						
							|  |  |  |     if options.bytes_only and options.unicode_only: | 
					
						
							|  |  |  |         raise SystemExit("Only one of --8-bit and --unicode are allowed") | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  |     bench_functions = [] | 
					
						
							|  |  |  |     for (k,v) in globals().items(): | 
					
						
							|  |  |  |         if hasattr(v, "is_bench"): | 
					
						
							|  |  |  |             if test_names: | 
					
						
							|  |  |  |                 for name in test_names: | 
					
						
							|  |  |  |                     if name in v.group: | 
					
						
							|  |  |  |                         break | 
					
						
							|  |  |  |                 else: | 
					
						
							|  |  |  |                     # Not selected, ignore | 
					
						
							|  |  |  |                     continue | 
					
						
							|  |  |  |             if options.skip_re and hasattr(v, "uses_re"): | 
					
						
							|  |  |  |                 continue | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  |             bench_functions.append( (v.group, k, v) ) | 
					
						
							|  |  |  |     bench_functions.sort() | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  |     p("bytes\tunicode") | 
					
						
							|  |  |  |     p("(in ms)\t(in ms)\t%\tcomment") | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  |     bytes_total = uni_total = 0.0 | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  |     for title, group in itertools.groupby(bench_functions, | 
					
						
							|  |  |  |                                       operator.itemgetter(0)): | 
					
						
							|  |  |  |         # Flush buffer before each group | 
					
						
							|  |  |  |         sys.stdout.flush() | 
					
						
							|  |  |  |         p("="*10, title) | 
					
						
							|  |  |  |         for (_, k, v) in group: | 
					
						
							|  |  |  |             if hasattr(v, "is_bench"): | 
					
						
							|  |  |  |                 bytes_time = 0.0 | 
					
						
							|  |  |  |                 bytes_time_s = " - " | 
					
						
							|  |  |  |                 if not options.unicode_only: | 
					
						
							|  |  |  |                     try: | 
					
						
							|  |  |  |                         bytes_time = BenchTimer("__main__.%s(__main__.BYTES)" % (k,), | 
					
						
							|  |  |  |                                                 "import __main__").best(REPEAT) | 
					
						
							|  |  |  |                         bytes_time_s = "%.2f" % (1000 * bytes_time) | 
					
						
							|  |  |  |                         bytes_total += bytes_time | 
					
						
							|  |  |  |                     except UnsupportedType: | 
					
						
							|  |  |  |                         bytes_time_s = "N/A" | 
					
						
							|  |  |  |                 uni_time = 0.0 | 
					
						
							|  |  |  |                 uni_time_s = " - " | 
					
						
							|  |  |  |                 if not options.bytes_only: | 
					
						
							|  |  |  |                     try: | 
					
						
							|  |  |  |                         uni_time = BenchTimer("__main__.%s(__main__.UNICODE)" % (k,), | 
					
						
							|  |  |  |                                               "import __main__").best(REPEAT) | 
					
						
							|  |  |  |                         uni_time_s = "%.2f" % (1000 * uni_time) | 
					
						
							|  |  |  |                         uni_total += uni_time | 
					
						
							|  |  |  |                     except UnsupportedType: | 
					
						
							|  |  |  |                         uni_time_s = "N/A" | 
					
						
							|  |  |  |                 try: | 
					
						
							|  |  |  |                     average = bytes_time/uni_time | 
					
						
							|  |  |  |                 except (TypeError, ZeroDivisionError): | 
					
						
							|  |  |  |                     average = 0.0 | 
					
						
							|  |  |  |                 p("%s\t%s\t%.1f\t%s (*%d)" % ( | 
					
						
							|  |  |  |                     bytes_time_s, uni_time_s, 100.*average, | 
					
						
							|  |  |  |                     v.comment, v.repeat_count)) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  |     if bytes_total == uni_total == 0.0: | 
					
						
							|  |  |  |         p("That was zippy!") | 
					
						
							|  |  |  |     else: | 
					
						
							|  |  |  |         try: | 
					
						
							|  |  |  |             ratio = bytes_total/uni_total | 
					
						
							|  |  |  |         except ZeroDivisionError: | 
					
						
							|  |  |  |             ratio = 0.0 | 
					
						
							|  |  |  |         p("%.2f\t%.2f\t%.1f\t%s" % ( | 
					
						
							|  |  |  |             1000*bytes_total, 1000*uni_total, 100.*ratio, | 
					
						
							|  |  |  |             "TOTAL")) | 
					
						
							|  |  |  | 
 | 
					
						
							|  |  |  | if __name__ == "__main__": | 
					
						
							|  |  |  |     main() |