mirror of
https://github.com/python/cpython.git
synced 2025-10-26 19:24:34 +00:00
requires them. Disable executable bits and shebang lines in test and benchmark files in order to prevent using a random system python, and in source files of modules which don't provide command line interface. Fixed shebang lines in the unittestgui and checkpip scripts.
1482 lines
43 KiB
Python
1482 lines
43 KiB
Python
|
|
# Various microbenchmarks comparing unicode and byte string performance
|
|
# Please keep this file both 2.x and 3.x compatible!
|
|
|
|
import timeit
|
|
import itertools
|
|
import operator
|
|
import re
|
|
import sys
|
|
import datetime
|
|
import optparse
|
|
|
|
VERSION = '2.0'
|
|
|
|
def p(*args):
|
|
sys.stdout.write(' '.join(str(s) for s in args) + '\n')
|
|
|
|
if sys.version_info >= (3,):
|
|
BYTES = bytes_from_str = lambda x: x.encode('ascii')
|
|
UNICODE = unicode_from_str = lambda x: x
|
|
else:
|
|
BYTES = bytes_from_str = lambda x: x
|
|
UNICODE = unicode_from_str = lambda x: x.decode('ascii')
|
|
|
|
class UnsupportedType(TypeError):
|
|
pass
|
|
|
|
|
|
p('stringbench v%s' % VERSION)
|
|
p(sys.version)
|
|
p(datetime.datetime.now())
|
|
|
|
REPEAT = 1
|
|
REPEAT = 3
|
|
#REPEAT = 7
|
|
|
|
if __name__ != "__main__":
|
|
raise SystemExit("Must run as main program")
|
|
|
|
parser = optparse.OptionParser()
|
|
parser.add_option("-R", "--skip-re", dest="skip_re",
|
|
action="store_true",
|
|
help="skip regular expression tests")
|
|
parser.add_option("-8", "--8-bit", dest="bytes_only",
|
|
action="store_true",
|
|
help="only do 8-bit string benchmarks")
|
|
parser.add_option("-u", "--unicode", dest="unicode_only",
|
|
action="store_true",
|
|
help="only do Unicode string benchmarks")
|
|
|
|
|
|
_RANGE_1000 = list(range(1000))
|
|
_RANGE_100 = list(range(100))
|
|
_RANGE_10 = list(range(10))
|
|
|
|
dups = {}
|
|
def bench(s, group, repeat_count):
|
|
def blah(f):
|
|
if f.__name__ in dups:
|
|
raise AssertionError("Multiple functions with same name: %r" %
|
|
(f.__name__,))
|
|
dups[f.__name__] = 1
|
|
f.comment = s
|
|
f.is_bench = True
|
|
f.group = group
|
|
f.repeat_count = repeat_count
|
|
return f
|
|
return blah
|
|
|
|
def uses_re(f):
|
|
f.uses_re = True
|
|
|
|
####### 'in' comparisons
|
|
|
|
@bench('"A" in "A"*1000', "early match, single character", 1000)
|
|
def in_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
for x in _RANGE_1000:
|
|
s2 in s1
|
|
|
|
@bench('"B" in "A"*1000', "no match, single character", 1000)
|
|
def in_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
for x in _RANGE_1000:
|
|
s2 in s1
|
|
|
|
|
|
@bench('"AB" in "AB"*1000', "early match, two characters", 1000)
|
|
def in_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
for x in _RANGE_1000:
|
|
s2 in s1
|
|
|
|
@bench('"BC" in "AB"*1000', "no match, two characters", 1000)
|
|
def in_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
for x in _RANGE_1000:
|
|
s2 in s1
|
|
|
|
@bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000)
|
|
def in_test_slow_match_two_characters(STR):
|
|
s1 = STR("AB" * 300+"C")
|
|
s2 = STR("BC")
|
|
for x in _RANGE_1000:
|
|
s2 in s1
|
|
|
|
@bench('s="ABC"*33; (s+"E") in ((s+"D")*300+s+"E")',
|
|
"late match, 100 characters", 100)
|
|
def in_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*300 + m+e
|
|
s2 = m+e
|
|
for x in _RANGE_100:
|
|
s2 in s1
|
|
|
|
# Try with regex
|
|
@uses_re
|
|
@bench('s="ABC"*33; re.compile(s+"D").search((s+"D")*300+s+"E")',
|
|
"late match, 100 characters", 100)
|
|
def re_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*300 + m+e
|
|
s2 = m+e
|
|
pat = re.compile(s2)
|
|
search = pat.search
|
|
for x in _RANGE_100:
|
|
search(s1)
|
|
|
|
|
|
#### same tests as 'in' but use 'find'
|
|
|
|
@bench('("A"*1000).find("A")', "early match, single character", 1000)
|
|
def find_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
@bench('("A"*1000).find("B")', "no match, single character", 1000)
|
|
def find_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
|
|
@bench('("AB"*1000).find("AB")', "early match, two characters", 1000)
|
|
def find_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
@bench('("AB"*1000).find("BC")', "no match, two characters", 1000)
|
|
def find_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
@bench('("AB"*1000).find("CA")', "no match, two characters", 1000)
|
|
def find_test_no_match_two_character_bis(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("CA")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
@bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000)
|
|
def find_test_slow_match_two_characters(STR):
|
|
s1 = STR("AB" * 300+"C")
|
|
s2 = STR("BC")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
@bench('("AB"*300+"CA").find("CA")', "late match, two characters", 1000)
|
|
def find_test_slow_match_two_characters_bis(STR):
|
|
s1 = STR("AB" * 300+"CA")
|
|
s2 = STR("CA")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
@bench('s="ABC"*33; ((s+"D")*500+s+"E").find(s+"E")',
|
|
"late match, 100 characters", 100)
|
|
def find_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*500 + m+e
|
|
s2 = m+e
|
|
s1_find = s1.find
|
|
for x in _RANGE_100:
|
|
s1_find(s2)
|
|
|
|
@bench('s="ABC"*33; ((s+"D")*500+"E"+s).find("E"+s)',
|
|
"late match, 100 characters", 100)
|
|
def find_test_slow_match_100_characters_bis(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*500 + e+m
|
|
s2 = e+m
|
|
s1_find = s1.find
|
|
for x in _RANGE_100:
|
|
s1_find(s2)
|
|
|
|
|
|
#### Same tests for 'rfind'
|
|
|
|
@bench('("A"*1000).rfind("A")', "early match, single character", 1000)
|
|
def rfind_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
@bench('("A"*1000).rfind("B")', "no match, single character", 1000)
|
|
def rfind_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
|
|
@bench('("AB"*1000).rfind("AB")', "early match, two characters", 1000)
|
|
def rfind_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
@bench('("AB"*1000).rfind("BC")', "no match, two characters", 1000)
|
|
def rfind_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
@bench('("AB"*1000).rfind("CA")', "no match, two characters", 1000)
|
|
def rfind_test_no_match_two_character_bis(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("CA")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
@bench('("C"+"AB"*300).rfind("CA")', "late match, two characters", 1000)
|
|
def rfind_test_slow_match_two_characters(STR):
|
|
s1 = STR("C" + "AB" * 300)
|
|
s2 = STR("CA")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
@bench('("BC"+"AB"*300).rfind("BC")', "late match, two characters", 1000)
|
|
def rfind_test_slow_match_two_characters_bis(STR):
|
|
s1 = STR("BC" + "AB" * 300)
|
|
s2 = STR("BC")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rfind("E"+s)',
|
|
"late match, 100 characters", 100)
|
|
def rfind_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = e+m + (d+m)*500
|
|
s2 = e+m
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_100:
|
|
s1_rfind(s2)
|
|
|
|
@bench('s="ABC"*33; (s+"E"+("D"+s)*500).rfind(s+"E")',
|
|
"late match, 100 characters", 100)
|
|
def rfind_test_slow_match_100_characters_bis(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = m+e + (d+m)*500
|
|
s2 = m+e
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_100:
|
|
s1_rfind(s2)
|
|
|
|
|
|
#### Now with index.
|
|
# Skip the ones which fail because that would include exception overhead.
|
|
|
|
@bench('("A"*1000).index("A")', "early match, single character", 1000)
|
|
def index_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_index = s1.index
|
|
for x in _RANGE_1000:
|
|
s1_index(s2)
|
|
|
|
@bench('("AB"*1000).index("AB")', "early match, two characters", 1000)
|
|
def index_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_index = s1.index
|
|
for x in _RANGE_1000:
|
|
s1_index(s2)
|
|
|
|
@bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000)
|
|
def index_test_slow_match_two_characters(STR):
|
|
s1 = STR("AB" * 300+"C")
|
|
s2 = STR("BC")
|
|
s1_index = s1.index
|
|
for x in _RANGE_1000:
|
|
s1_index(s2)
|
|
|
|
@bench('s="ABC"*33; ((s+"D")*500+s+"E").index(s+"E")',
|
|
"late match, 100 characters", 100)
|
|
def index_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*500 + m+e
|
|
s2 = m+e
|
|
s1_index = s1.index
|
|
for x in _RANGE_100:
|
|
s1_index(s2)
|
|
|
|
|
|
#### Same for rindex
|
|
|
|
@bench('("A"*1000).rindex("A")', "early match, single character", 1000)
|
|
def rindex_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_rindex = s1.rindex
|
|
for x in _RANGE_1000:
|
|
s1_rindex(s2)
|
|
|
|
@bench('("AB"*1000).rindex("AB")', "early match, two characters", 1000)
|
|
def rindex_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_rindex = s1.rindex
|
|
for x in _RANGE_1000:
|
|
s1_rindex(s2)
|
|
|
|
@bench('("C"+"AB"*300).rindex("CA")', "late match, two characters", 1000)
|
|
def rindex_test_slow_match_two_characters(STR):
|
|
s1 = STR("C" + "AB" * 300)
|
|
s2 = STR("CA")
|
|
s1_rindex = s1.rindex
|
|
for x in _RANGE_1000:
|
|
s1_rindex(s2)
|
|
|
|
@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rindex("E"+s)',
|
|
"late match, 100 characters", 100)
|
|
def rindex_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = e + m + (d+m)*500
|
|
s2 = e + m
|
|
s1_rindex = s1.rindex
|
|
for x in _RANGE_100:
|
|
s1_rindex(s2)
|
|
|
|
|
|
#### Same for partition
|
|
|
|
@bench('("A"*1000).partition("A")', "early match, single character", 1000)
|
|
def partition_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_partition = s1.partition
|
|
for x in _RANGE_1000:
|
|
s1_partition(s2)
|
|
|
|
@bench('("A"*1000).partition("B")', "no match, single character", 1000)
|
|
def partition_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
s1_partition = s1.partition
|
|
for x in _RANGE_1000:
|
|
s1_partition(s2)
|
|
|
|
|
|
@bench('("AB"*1000).partition("AB")', "early match, two characters", 1000)
|
|
def partition_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_partition = s1.partition
|
|
for x in _RANGE_1000:
|
|
s1_partition(s2)
|
|
|
|
@bench('("AB"*1000).partition("BC")', "no match, two characters", 1000)
|
|
def partition_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
s1_partition = s1.partition
|
|
for x in _RANGE_1000:
|
|
s1_partition(s2)
|
|
|
|
@bench('("AB"*300+"C").partition("BC")', "late match, two characters", 1000)
|
|
def partition_test_slow_match_two_characters(STR):
|
|
s1 = STR("AB" * 300+"C")
|
|
s2 = STR("BC")
|
|
s1_partition = s1.partition
|
|
for x in _RANGE_1000:
|
|
s1_partition(s2)
|
|
|
|
@bench('s="ABC"*33; ((s+"D")*500+s+"E").partition(s+"E")',
|
|
"late match, 100 characters", 100)
|
|
def partition_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*500 + m+e
|
|
s2 = m+e
|
|
s1_partition = s1.partition
|
|
for x in _RANGE_100:
|
|
s1_partition(s2)
|
|
|
|
|
|
#### Same for rpartition
|
|
|
|
@bench('("A"*1000).rpartition("A")', "early match, single character", 1000)
|
|
def rpartition_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_rpartition = s1.rpartition
|
|
for x in _RANGE_1000:
|
|
s1_rpartition(s2)
|
|
|
|
@bench('("A"*1000).rpartition("B")', "no match, single character", 1000)
|
|
def rpartition_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
s1_rpartition = s1.rpartition
|
|
for x in _RANGE_1000:
|
|
s1_rpartition(s2)
|
|
|
|
|
|
@bench('("AB"*1000).rpartition("AB")', "early match, two characters", 1000)
|
|
def rpartition_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_rpartition = s1.rpartition
|
|
for x in _RANGE_1000:
|
|
s1_rpartition(s2)
|
|
|
|
@bench('("AB"*1000).rpartition("BC")', "no match, two characters", 1000)
|
|
def rpartition_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
s1_rpartition = s1.rpartition
|
|
for x in _RANGE_1000:
|
|
s1_rpartition(s2)
|
|
|
|
@bench('("C"+"AB"*300).rpartition("CA")', "late match, two characters", 1000)
|
|
def rpartition_test_slow_match_two_characters(STR):
|
|
s1 = STR("C" + "AB" * 300)
|
|
s2 = STR("CA")
|
|
s1_rpartition = s1.rpartition
|
|
for x in _RANGE_1000:
|
|
s1_rpartition(s2)
|
|
|
|
@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rpartition("E"+s)',
|
|
"late match, 100 characters", 100)
|
|
def rpartition_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = e + m + (d+m)*500
|
|
s2 = e + m
|
|
s1_rpartition = s1.rpartition
|
|
for x in _RANGE_100:
|
|
s1_rpartition(s2)
|
|
|
|
|
|
#### Same for split(s, 1)
|
|
|
|
@bench('("A"*1000).split("A", 1)', "early match, single character", 1000)
|
|
def split_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_split = s1.split
|
|
for x in _RANGE_1000:
|
|
s1_split(s2, 1)
|
|
|
|
@bench('("A"*1000).split("B", 1)', "no match, single character", 1000)
|
|
def split_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
s1_split = s1.split
|
|
for x in _RANGE_1000:
|
|
s1_split(s2, 1)
|
|
|
|
|
|
@bench('("AB"*1000).split("AB", 1)', "early match, two characters", 1000)
|
|
def split_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_split = s1.split
|
|
for x in _RANGE_1000:
|
|
s1_split(s2, 1)
|
|
|
|
@bench('("AB"*1000).split("BC", 1)', "no match, two characters", 1000)
|
|
def split_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
s1_split = s1.split
|
|
for x in _RANGE_1000:
|
|
s1_split(s2, 1)
|
|
|
|
@bench('("AB"*300+"C").split("BC", 1)', "late match, two characters", 1000)
|
|
def split_test_slow_match_two_characters(STR):
|
|
s1 = STR("AB" * 300+"C")
|
|
s2 = STR("BC")
|
|
s1_split = s1.split
|
|
for x in _RANGE_1000:
|
|
s1_split(s2, 1)
|
|
|
|
@bench('s="ABC"*33; ((s+"D")*500+s+"E").split(s+"E", 1)',
|
|
"late match, 100 characters", 100)
|
|
def split_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*500 + m+e
|
|
s2 = m+e
|
|
s1_split = s1.split
|
|
for x in _RANGE_100:
|
|
s1_split(s2, 1)
|
|
|
|
|
|
#### Same for rsplit(s, 1)
|
|
|
|
@bench('("A"*1000).rsplit("A", 1)', "early match, single character", 1000)
|
|
def rsplit_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_rsplit = s1.rsplit
|
|
for x in _RANGE_1000:
|
|
s1_rsplit(s2, 1)
|
|
|
|
@bench('("A"*1000).rsplit("B", 1)', "no match, single character", 1000)
|
|
def rsplit_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
s1_rsplit = s1.rsplit
|
|
for x in _RANGE_1000:
|
|
s1_rsplit(s2, 1)
|
|
|
|
|
|
@bench('("AB"*1000).rsplit("AB", 1)', "early match, two characters", 1000)
|
|
def rsplit_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_rsplit = s1.rsplit
|
|
for x in _RANGE_1000:
|
|
s1_rsplit(s2, 1)
|
|
|
|
@bench('("AB"*1000).rsplit("BC", 1)', "no match, two characters", 1000)
|
|
def rsplit_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
s1_rsplit = s1.rsplit
|
|
for x in _RANGE_1000:
|
|
s1_rsplit(s2, 1)
|
|
|
|
@bench('("C"+"AB"*300).rsplit("CA", 1)', "late match, two characters", 1000)
|
|
def rsplit_test_slow_match_two_characters(STR):
|
|
s1 = STR("C" + "AB" * 300)
|
|
s2 = STR("CA")
|
|
s1_rsplit = s1.rsplit
|
|
for x in _RANGE_1000:
|
|
s1_rsplit(s2, 1)
|
|
|
|
@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rsplit("E"+s, 1)',
|
|
"late match, 100 characters", 100)
|
|
def rsplit_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = e + m + (d+m)*500
|
|
s2 = e + m
|
|
s1_rsplit = s1.rsplit
|
|
for x in _RANGE_100:
|
|
s1_rsplit(s2, 1)
|
|
|
|
|
|
#### Benchmark the operator-based methods
|
|
|
|
@bench('"A"*10', "repeat 1 character 10 times", 1000)
|
|
def repeat_single_10_times(STR):
|
|
s = STR("A")
|
|
for x in _RANGE_1000:
|
|
s * 10
|
|
|
|
@bench('"A"*1000', "repeat 1 character 1000 times", 1000)
|
|
def repeat_single_1000_times(STR):
|
|
s = STR("A")
|
|
for x in _RANGE_1000:
|
|
s * 1000
|
|
|
|
@bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000)
|
|
def repeat_5_10_times(STR):
|
|
s = STR("ABCDE")
|
|
for x in _RANGE_1000:
|
|
s * 10
|
|
|
|
@bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000)
|
|
def repeat_5_1000_times(STR):
|
|
s = STR("ABCDE")
|
|
for x in _RANGE_1000:
|
|
s * 1000
|
|
|
|
# + for concat
|
|
|
|
@bench('"Andrew"+"Dalke"', "concat two strings", 1000)
|
|
def concat_two_strings(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("Dalke")
|
|
for x in _RANGE_1000:
|
|
s1+s2
|
|
|
|
@bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15",
|
|
1000)
|
|
def concat_many_strings(STR):
|
|
s1=STR('TIXSGYNREDCVBHJ')
|
|
s2=STR('PUMTLXBZVDO')
|
|
s3=STR('FVZNJ')
|
|
s4=STR('OGDXUW')
|
|
s5=STR('WEIMRNCOYVGHKB')
|
|
s6=STR('FCQTNMXPUZH')
|
|
s7=STR('TICZJYRLBNVUEAK')
|
|
s8=STR('REYB')
|
|
s9=STR('PWUOQ')
|
|
s10=STR('EQHCMKBS')
|
|
s11=STR('AEVDFOH')
|
|
s12=STR('IFHVD')
|
|
s13=STR('JGTCNLXWOHQ')
|
|
s14=STR('ITSKEPYLROZAWXF')
|
|
s15=STR('THEK')
|
|
s16=STR('GHPZFBUYCKMNJIT')
|
|
s17=STR('JMUZ')
|
|
s18=STR('WLZQMTB')
|
|
s19=STR('KPADCBW')
|
|
s20=STR('TNJHZQAGBU')
|
|
for x in _RANGE_1000:
|
|
(s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+
|
|
s11+s12+s13+s14+s15+s16+s17+s18+s19+s20)
|
|
|
|
|
|
#### Benchmark join
|
|
|
|
def get_bytes_yielding_seq(STR, arg):
|
|
if STR is BYTES and sys.version_info >= (3,):
|
|
raise UnsupportedType
|
|
return STR(arg)
|
|
|
|
@bench('"A".join("")',
|
|
"join empty string, with 1 character sep", 100)
|
|
def join_empty_single(STR):
|
|
sep = STR("A")
|
|
s2 = get_bytes_yielding_seq(STR, "")
|
|
sep_join = sep.join
|
|
for x in _RANGE_100:
|
|
sep_join(s2)
|
|
|
|
@bench('"ABCDE".join("")',
|
|
"join empty string, with 5 character sep", 100)
|
|
def join_empty_5(STR):
|
|
sep = STR("ABCDE")
|
|
s2 = get_bytes_yielding_seq(STR, "")
|
|
sep_join = sep.join
|
|
for x in _RANGE_100:
|
|
sep_join(s2)
|
|
|
|
@bench('"A".join("ABC..Z")',
|
|
"join string with 26 characters, with 1 character sep", 1000)
|
|
def join_alphabet_single(STR):
|
|
sep = STR("A")
|
|
s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ")
|
|
sep_join = sep.join
|
|
for x in _RANGE_1000:
|
|
sep_join(s2)
|
|
|
|
@bench('"ABCDE".join("ABC..Z")',
|
|
"join string with 26 characters, with 5 character sep", 1000)
|
|
def join_alphabet_5(STR):
|
|
sep = STR("ABCDE")
|
|
s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ")
|
|
sep_join = sep.join
|
|
for x in _RANGE_1000:
|
|
sep_join(s2)
|
|
|
|
@bench('"A".join(list("ABC..Z"))',
|
|
"join list of 26 characters, with 1 character sep", 1000)
|
|
def join_alphabet_list_single(STR):
|
|
sep = STR("A")
|
|
s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"]
|
|
sep_join = sep.join
|
|
for x in _RANGE_1000:
|
|
sep_join(s2)
|
|
|
|
@bench('"ABCDE".join(list("ABC..Z"))',
|
|
"join list of 26 characters, with 5 character sep", 1000)
|
|
def join_alphabet_list_five(STR):
|
|
sep = STR("ABCDE")
|
|
s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"]
|
|
sep_join = sep.join
|
|
for x in _RANGE_1000:
|
|
sep_join(s2)
|
|
|
|
@bench('"A".join(["Bob"]*100))',
|
|
"join list of 100 words, with 1 character sep", 1000)
|
|
def join_100_words_single(STR):
|
|
sep = STR("A")
|
|
s2 = [STR("Bob")]*100
|
|
sep_join = sep.join
|
|
for x in _RANGE_1000:
|
|
sep_join(s2)
|
|
|
|
@bench('"ABCDE".join(["Bob"]*100))',
|
|
"join list of 100 words, with 5 character sep", 1000)
|
|
def join_100_words_5(STR):
|
|
sep = STR("ABCDE")
|
|
s2 = [STR("Bob")]*100
|
|
sep_join = sep.join
|
|
for x in _RANGE_1000:
|
|
sep_join(s2)
|
|
|
|
#### split tests
|
|
|
|
@bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000)
|
|
def whitespace_split(STR):
|
|
s = STR("Here are some words. "*2)
|
|
s_split = s.split
|
|
for x in _RANGE_1000:
|
|
s_split()
|
|
|
|
@bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000)
|
|
def whitespace_rsplit(STR):
|
|
s = STR("Here are some words. "*2)
|
|
s_rsplit = s.rsplit
|
|
for x in _RANGE_1000:
|
|
s_rsplit()
|
|
|
|
@bench('("Here are some words. "*2).split(None, 1)',
|
|
"split 1 whitespace", 1000)
|
|
def whitespace_split_1(STR):
|
|
s = STR("Here are some words. "*2)
|
|
s_split = s.split
|
|
N = None
|
|
for x in _RANGE_1000:
|
|
s_split(N, 1)
|
|
|
|
@bench('("Here are some words. "*2).rsplit(None, 1)',
|
|
"split 1 whitespace", 1000)
|
|
def whitespace_rsplit_1(STR):
|
|
s = STR("Here are some words. "*2)
|
|
s_rsplit = s.rsplit
|
|
N = None
|
|
for x in _RANGE_1000:
|
|
s_rsplit(N, 1)
|
|
|
|
@bench('("Here are some words. "*2).partition(" ")',
|
|
"split 1 whitespace", 1000)
|
|
def whitespace_partition(STR):
|
|
sep = STR(" ")
|
|
s = STR("Here are some words. "*2)
|
|
s_partition = s.partition
|
|
for x in _RANGE_1000:
|
|
s_partition(sep)
|
|
|
|
@bench('("Here are some words. "*2).rpartition(" ")',
|
|
"split 1 whitespace", 1000)
|
|
def whitespace_rpartition(STR):
|
|
sep = STR(" ")
|
|
s = STR("Here are some words. "*2)
|
|
s_rpartition = s.rpartition
|
|
for x in _RANGE_1000:
|
|
s_rpartition(sep)
|
|
|
|
human_text = """\
|
|
Python is a dynamic object-oriented programming language that can be
|
|
used for many kinds of software development. It offers strong support
|
|
for integration with other languages and tools, comes with extensive
|
|
standard libraries, and can be learned in a few days. Many Python
|
|
programmers report substantial productivity gains and feel the language
|
|
encourages the development of higher quality, more maintainable code.
|
|
|
|
Python runs on Windows, Linux/Unix, Mac OS X, Amiga, Palm
|
|
Handhelds, and Nokia mobile phones. Python has also been ported to the
|
|
Java and .NET virtual machines.
|
|
|
|
Python is distributed under an OSI-approved open source license that
|
|
makes it free to use, even for commercial products.
|
|
"""*25
|
|
human_text_bytes = bytes_from_str(human_text)
|
|
human_text_unicode = unicode_from_str(human_text)
|
|
def _get_human_text(STR):
|
|
if STR is UNICODE:
|
|
return human_text_unicode
|
|
if STR is BYTES:
|
|
return human_text_bytes
|
|
raise AssertionError
|
|
|
|
@bench('human_text.split()', "split whitespace (huge)", 10)
|
|
def whitespace_split_huge(STR):
|
|
s = _get_human_text(STR)
|
|
s_split = s.split
|
|
for x in _RANGE_10:
|
|
s_split()
|
|
|
|
@bench('human_text.rsplit()', "split whitespace (huge)", 10)
|
|
def whitespace_rsplit_huge(STR):
|
|
s = _get_human_text(STR)
|
|
s_rsplit = s.rsplit
|
|
for x in _RANGE_10:
|
|
s_rsplit()
|
|
|
|
|
|
|
|
@bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000)
|
|
def newlines_split(STR):
|
|
s = STR("this\nis\na\ntest\n")
|
|
s_split = s.split
|
|
nl = STR("\n")
|
|
for x in _RANGE_1000:
|
|
s_split(nl)
|
|
|
|
|
|
@bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000)
|
|
def newlines_rsplit(STR):
|
|
s = STR("this\nis\na\ntest\n")
|
|
s_rsplit = s.rsplit
|
|
nl = STR("\n")
|
|
for x in _RANGE_1000:
|
|
s_rsplit(nl)
|
|
|
|
@bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000)
|
|
def newlines_splitlines(STR):
|
|
s = STR("this\nis\na\ntest\n")
|
|
s_splitlines = s.splitlines
|
|
for x in _RANGE_1000:
|
|
s_splitlines()
|
|
|
|
## split text with 2000 newlines
|
|
|
|
def _make_2000_lines():
|
|
import random
|
|
r = random.Random(100)
|
|
chars = list(map(chr, range(32, 128)))
|
|
i = 0
|
|
while i < len(chars):
|
|
chars[i] = " "
|
|
i += r.randrange(9)
|
|
s = "".join(chars)
|
|
s = s*4
|
|
words = []
|
|
for i in range(2000):
|
|
start = r.randrange(96)
|
|
n = r.randint(5, 65)
|
|
words.append(s[start:start+n])
|
|
return "\n".join(words)+"\n"
|
|
|
|
_text_with_2000_lines = _make_2000_lines()
|
|
_text_with_2000_lines_bytes = bytes_from_str(_text_with_2000_lines)
|
|
_text_with_2000_lines_unicode = unicode_from_str(_text_with_2000_lines)
|
|
def _get_2000_lines(STR):
|
|
if STR is UNICODE:
|
|
return _text_with_2000_lines_unicode
|
|
if STR is BYTES:
|
|
return _text_with_2000_lines_bytes
|
|
raise AssertionError
|
|
|
|
|
|
@bench('"...text...".split("\\n")', "split 2000 newlines", 10)
|
|
def newlines_split_2000(STR):
|
|
s = _get_2000_lines(STR)
|
|
s_split = s.split
|
|
nl = STR("\n")
|
|
for x in _RANGE_10:
|
|
s_split(nl)
|
|
|
|
@bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10)
|
|
def newlines_rsplit_2000(STR):
|
|
s = _get_2000_lines(STR)
|
|
s_rsplit = s.rsplit
|
|
nl = STR("\n")
|
|
for x in _RANGE_10:
|
|
s_rsplit(nl)
|
|
|
|
@bench('"...text...".splitlines()', "split 2000 newlines", 10)
|
|
def newlines_splitlines_2000(STR):
|
|
s = _get_2000_lines(STR)
|
|
s_splitlines = s.splitlines
|
|
for x in _RANGE_10:
|
|
s_splitlines()
|
|
|
|
|
|
## split text on "--" characters
|
|
@bench(
|
|
'"this--is--a--test--of--the--emergency--broadcast--system".split("--")',
|
|
"split on multicharacter separator (small)", 1000)
|
|
def split_multichar_sep_small(STR):
|
|
s = STR("this--is--a--test--of--the--emergency--broadcast--system")
|
|
s_split = s.split
|
|
pat = STR("--")
|
|
for x in _RANGE_1000:
|
|
s_split(pat)
|
|
@bench(
|
|
'"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")',
|
|
"split on multicharacter separator (small)", 1000)
|
|
def rsplit_multichar_sep_small(STR):
|
|
s = STR("this--is--a--test--of--the--emergency--broadcast--system")
|
|
s_rsplit = s.rsplit
|
|
pat = STR("--")
|
|
for x in _RANGE_1000:
|
|
s_rsplit(pat)
|
|
|
|
## split dna text on "ACTAT" characters
|
|
@bench('dna.split("ACTAT")',
|
|
"split on multicharacter separator (dna)", 10)
|
|
def split_multichar_sep_dna(STR):
|
|
s = _get_dna(STR)
|
|
s_split = s.split
|
|
pat = STR("ACTAT")
|
|
for x in _RANGE_10:
|
|
s_split(pat)
|
|
|
|
@bench('dna.rsplit("ACTAT")',
|
|
"split on multicharacter separator (dna)", 10)
|
|
def rsplit_multichar_sep_dna(STR):
|
|
s = _get_dna(STR)
|
|
s_rsplit = s.rsplit
|
|
pat = STR("ACTAT")
|
|
for x in _RANGE_10:
|
|
s_rsplit(pat)
|
|
|
|
|
|
|
|
## split with limits
|
|
|
|
GFF3_example = "\t".join([
|
|
"I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".",
|
|
"ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"])
|
|
|
|
@bench('GFF3_example.split("\\t")', "tab split", 1000)
|
|
def tab_split_no_limit(STR):
|
|
sep = STR("\t")
|
|
s = STR(GFF3_example)
|
|
s_split = s.split
|
|
for x in _RANGE_1000:
|
|
s_split(sep)
|
|
|
|
@bench('GFF3_example.split("\\t", 8)', "tab split", 1000)
|
|
def tab_split_limit(STR):
|
|
sep = STR("\t")
|
|
s = STR(GFF3_example)
|
|
s_split = s.split
|
|
for x in _RANGE_1000:
|
|
s_split(sep, 8)
|
|
|
|
@bench('GFF3_example.rsplit("\\t")', "tab split", 1000)
|
|
def tab_rsplit_no_limit(STR):
|
|
sep = STR("\t")
|
|
s = STR(GFF3_example)
|
|
s_rsplit = s.rsplit
|
|
for x in _RANGE_1000:
|
|
s_rsplit(sep)
|
|
|
|
@bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000)
|
|
def tab_rsplit_limit(STR):
|
|
sep = STR("\t")
|
|
s = STR(GFF3_example)
|
|
s_rsplit = s.rsplit
|
|
for x in _RANGE_1000:
|
|
s_rsplit(sep, 8)
|
|
|
|
#### Count characters
|
|
|
|
@bench('...text.with.2000.newlines.count("\\n")',
|
|
"count newlines", 10)
|
|
def count_newlines(STR):
|
|
s = _get_2000_lines(STR)
|
|
s_count = s.count
|
|
nl = STR("\n")
|
|
for x in _RANGE_10:
|
|
s_count(nl)
|
|
|
|
# Orchid sequences concatenated, from Biopython
|
|
_dna = """
|
|
CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT
|
|
AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG
|
|
AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT
|
|
TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC
|
|
AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG
|
|
TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT
|
|
CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
|
|
TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT
|
|
GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC
|
|
TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG
|
|
GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA
|
|
ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC
|
|
CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA
|
|
ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA
|
|
ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA
|
|
TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG
|
|
CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG
|
|
GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA
|
|
ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG
|
|
ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC
|
|
ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA
|
|
GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA
|
|
TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG
|
|
TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT
|
|
TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG
|
|
GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG
|
|
GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT
|
|
AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC
|
|
GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG
|
|
TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT
|
|
CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA
|
|
TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC
|
|
TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC
|
|
AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT
|
|
GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT
|
|
GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA
|
|
CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG
|
|
GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA
|
|
TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG
|
|
ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT
|
|
GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA
|
|
AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC
|
|
AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA
|
|
ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC
|
|
GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC
|
|
GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC
|
|
AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA
|
|
GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG
|
|
ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC
|
|
GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC
|
|
"""
|
|
_dna = "".join(_dna.splitlines())
|
|
_dna = _dna * 25
|
|
_dna_bytes = bytes_from_str(_dna)
|
|
_dna_unicode = unicode_from_str(_dna)
|
|
|
|
def _get_dna(STR):
|
|
if STR is UNICODE:
|
|
return _dna_unicode
|
|
if STR is BYTES:
|
|
return _dna_bytes
|
|
raise AssertionError
|
|
|
|
@bench('dna.count("AACT")', "count AACT substrings in DNA example", 10)
|
|
def count_aact(STR):
|
|
seq = _get_dna(STR)
|
|
seq_count = seq.count
|
|
needle = STR("AACT")
|
|
for x in _RANGE_10:
|
|
seq_count(needle)
|
|
|
|
##### startswith and endswith
|
|
|
|
@bench('"Andrew".startswith("A")', 'startswith single character', 1000)
|
|
def startswith_single(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("A")
|
|
s1_startswith = s1.startswith
|
|
for x in _RANGE_1000:
|
|
s1_startswith(s2)
|
|
|
|
@bench('"Andrew".startswith("Andrew")', 'startswith multiple characters',
|
|
1000)
|
|
def startswith_multiple(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("Andrew")
|
|
s1_startswith = s1.startswith
|
|
for x in _RANGE_1000:
|
|
s1_startswith(s2)
|
|
|
|
@bench('"Andrew".startswith("Anders")',
|
|
'startswith multiple characters - not!', 1000)
|
|
def startswith_multiple_not(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("Anders")
|
|
s1_startswith = s1.startswith
|
|
for x in _RANGE_1000:
|
|
s1_startswith(s2)
|
|
|
|
|
|
# endswith
|
|
|
|
@bench('"Andrew".endswith("w")', 'endswith single character', 1000)
|
|
def endswith_single(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("w")
|
|
s1_endswith = s1.endswith
|
|
for x in _RANGE_1000:
|
|
s1_endswith(s2)
|
|
|
|
@bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000)
|
|
def endswith_multiple(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("Andrew")
|
|
s1_endswith = s1.endswith
|
|
for x in _RANGE_1000:
|
|
s1_endswith(s2)
|
|
|
|
@bench('"Andrew".endswith("Anders")',
|
|
'endswith multiple characters - not!', 1000)
|
|
def endswith_multiple_not(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("Anders")
|
|
s1_endswith = s1.endswith
|
|
for x in _RANGE_1000:
|
|
s1_endswith(s2)
|
|
|
|
#### Strip
|
|
|
|
@bench('"Hello!\\n".strip()', 'strip terminal newline', 1000)
|
|
def terminal_newline_strip_right(STR):
|
|
s = STR("Hello!\n")
|
|
s_strip = s.strip
|
|
for x in _RANGE_1000:
|
|
s_strip()
|
|
|
|
@bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000)
|
|
def terminal_newline_rstrip(STR):
|
|
s = STR("Hello!\n")
|
|
s_rstrip = s.rstrip
|
|
for x in _RANGE_1000:
|
|
s_rstrip()
|
|
|
|
@bench('"\\nHello!".strip()', 'strip terminal newline', 1000)
|
|
def terminal_newline_strip_left(STR):
|
|
s = STR("\nHello!")
|
|
s_strip = s.strip
|
|
for x in _RANGE_1000:
|
|
s_strip()
|
|
|
|
@bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000)
|
|
def terminal_newline_strip_both(STR):
|
|
s = STR("\nHello!\n")
|
|
s_strip = s.strip
|
|
for x in _RANGE_1000:
|
|
s_strip()
|
|
|
|
@bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000)
|
|
def terminal_newline_lstrip(STR):
|
|
s = STR("\nHello!")
|
|
s_lstrip = s.lstrip
|
|
for x in _RANGE_1000:
|
|
s_lstrip()
|
|
|
|
@bench('s="Hello!\\n"; s[:-1] if s[-1]=="\\n" else s',
|
|
'strip terminal newline', 1000)
|
|
def terminal_newline_if_else(STR):
|
|
s = STR("Hello!\n")
|
|
NL = STR("\n")
|
|
for x in _RANGE_1000:
|
|
s[:-1] if (s[-1] == NL) else s
|
|
|
|
|
|
# Strip multiple spaces or tabs
|
|
|
|
@bench('"Hello\\t \\t".strip()', 'strip terminal spaces and tabs', 1000)
|
|
def terminal_space_strip(STR):
|
|
s = STR("Hello\t \t!")
|
|
s_strip = s.strip
|
|
for x in _RANGE_1000:
|
|
s_strip()
|
|
|
|
@bench('"Hello\\t \\t".rstrip()', 'strip terminal spaces and tabs', 1000)
|
|
def terminal_space_rstrip(STR):
|
|
s = STR("Hello!\t \t")
|
|
s_rstrip = s.rstrip
|
|
for x in _RANGE_1000:
|
|
s_rstrip()
|
|
|
|
@bench('"\\t \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000)
|
|
def terminal_space_lstrip(STR):
|
|
s = STR("\t \tHello!")
|
|
s_lstrip = s.lstrip
|
|
for x in _RANGE_1000:
|
|
s_lstrip()
|
|
|
|
|
|
#### replace
|
|
@bench('"This is a test".replace(" ", "\\t")', 'replace single character',
|
|
1000)
|
|
def replace_single_character(STR):
|
|
s = STR("This is a test!")
|
|
from_str = STR(" ")
|
|
to_str = STR("\t")
|
|
s_replace = s.replace
|
|
for x in _RANGE_1000:
|
|
s_replace(from_str, to_str)
|
|
|
|
@uses_re
|
|
@bench('re.sub(" ", "\\t", "This is a test"', 'replace single character',
|
|
1000)
|
|
def replace_single_character_re(STR):
|
|
s = STR("This is a test!")
|
|
pat = re.compile(STR(" "))
|
|
to_str = STR("\t")
|
|
pat_sub = pat.sub
|
|
for x in _RANGE_1000:
|
|
pat_sub(to_str, s)
|
|
|
|
@bench('"...text.with.2000.lines...replace("\\n", " ")',
|
|
'replace single character, big string', 10)
|
|
def replace_single_character_big(STR):
|
|
s = _get_2000_lines(STR)
|
|
from_str = STR("\n")
|
|
to_str = STR(" ")
|
|
s_replace = s.replace
|
|
for x in _RANGE_10:
|
|
s_replace(from_str, to_str)
|
|
|
|
@uses_re
|
|
@bench('re.sub("\\n", " ", "...text.with.2000.lines...")',
|
|
'replace single character, big string', 10)
|
|
def replace_single_character_big_re(STR):
|
|
s = _get_2000_lines(STR)
|
|
pat = re.compile(STR("\n"))
|
|
to_str = STR(" ")
|
|
pat_sub = pat.sub
|
|
for x in _RANGE_10:
|
|
pat_sub(to_str, s)
|
|
|
|
|
|
@bench('dna.replace("ATC", "ATT")',
|
|
'replace multiple characters, dna', 10)
|
|
def replace_multiple_characters_dna(STR):
|
|
seq = _get_dna(STR)
|
|
from_str = STR("ATC")
|
|
to_str = STR("ATT")
|
|
seq_replace = seq.replace
|
|
for x in _RANGE_10:
|
|
seq_replace(from_str, to_str)
|
|
|
|
# This increases the character count
|
|
@bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")',
|
|
'replace and expand multiple characters, big string', 10)
|
|
def replace_multiple_character_big(STR):
|
|
s = _get_2000_lines(STR)
|
|
from_str = STR("\n")
|
|
to_str = STR("\r\n")
|
|
s_replace = s.replace
|
|
for x in _RANGE_10:
|
|
s_replace(from_str, to_str)
|
|
|
|
|
|
# This decreases the character count
|
|
@bench('"When shall we three meet again?".replace("ee", "")',
|
|
'replace/remove multiple characters', 1000)
|
|
def replace_multiple_character_remove(STR):
|
|
s = STR("When shall we three meet again?")
|
|
from_str = STR("ee")
|
|
to_str = STR("")
|
|
s_replace = s.replace
|
|
for x in _RANGE_1000:
|
|
s_replace(from_str, to_str)
|
|
|
|
|
|
big_s = "A" + ("Z"*128*1024)
|
|
big_s_bytes = bytes_from_str(big_s)
|
|
big_s_unicode = unicode_from_str(big_s)
|
|
def _get_big_s(STR):
|
|
if STR is UNICODE: return big_s_unicode
|
|
if STR is BYTES: return big_s_bytes
|
|
raise AssertionError
|
|
|
|
# The older replace implementation counted all matches in
|
|
# the string even when it only needed to make one replacement.
|
|
@bench('("A" + ("Z"*128*1024)).replace("A", "BB", 1)',
|
|
'quick replace single character match', 10)
|
|
def quick_replace_single_match(STR):
|
|
s = _get_big_s(STR)
|
|
from_str = STR("A")
|
|
to_str = STR("BB")
|
|
s_replace = s.replace
|
|
for x in _RANGE_10:
|
|
s_replace(from_str, to_str, 1)
|
|
|
|
@bench('("A" + ("Z"*128*1024)).replace("AZZ", "BBZZ", 1)',
|
|
'quick replace multiple character match', 10)
|
|
def quick_replace_multiple_match(STR):
|
|
s = _get_big_s(STR)
|
|
from_str = STR("AZZ")
|
|
to_str = STR("BBZZ")
|
|
s_replace = s.replace
|
|
for x in _RANGE_10:
|
|
s_replace(from_str, to_str, 1)
|
|
|
|
|
|
####
|
|
|
|
# CCP does a lot of this, for internationalisation of ingame messages.
|
|
_format = "The %(thing)s is %(place)s the %(location)s."
|
|
_format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", }
|
|
_format_bytes = bytes_from_str(_format)
|
|
_format_unicode = unicode_from_str(_format)
|
|
_format_dict_bytes = dict((bytes_from_str(k), bytes_from_str(v)) for (k,v) in _format_dict.items())
|
|
_format_dict_unicode = dict((unicode_from_str(k), unicode_from_str(v)) for (k,v) in _format_dict.items())
|
|
|
|
def _get_format(STR):
|
|
if STR is UNICODE:
|
|
return _format_unicode
|
|
if STR is BYTES:
|
|
if sys.version_info >= (3,):
|
|
raise UnsupportedType
|
|
return _format_bytes
|
|
raise AssertionError
|
|
|
|
def _get_format_dict(STR):
|
|
if STR is UNICODE:
|
|
return _format_dict_unicode
|
|
if STR is BYTES:
|
|
if sys.version_info >= (3,):
|
|
raise UnsupportedType
|
|
return _format_dict_bytes
|
|
raise AssertionError
|
|
|
|
# Formatting.
|
|
@bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}',
|
|
'formatting a string type with a dict', 1000)
|
|
def format_with_dict(STR):
|
|
s = _get_format(STR)
|
|
d = _get_format_dict(STR)
|
|
for x in _RANGE_1000:
|
|
s % d
|
|
|
|
|
|
#### Upper- and lower- case conversion
|
|
|
|
@bench('("Where in the world is Carmen San Deigo?"*10).lower()',
|
|
"case conversion -- rare", 1000)
|
|
def lower_conversion_rare(STR):
|
|
s = STR("Where in the world is Carmen San Deigo?"*10)
|
|
s_lower = s.lower
|
|
for x in _RANGE_1000:
|
|
s_lower()
|
|
|
|
@bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()',
|
|
"case conversion -- dense", 1000)
|
|
def lower_conversion_dense(STR):
|
|
s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10)
|
|
s_lower = s.lower
|
|
for x in _RANGE_1000:
|
|
s_lower()
|
|
|
|
|
|
@bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()',
|
|
"case conversion -- rare", 1000)
|
|
def upper_conversion_rare(STR):
|
|
s = STR("Where in the world is Carmen San Deigo?"*10)
|
|
s_upper = s.upper
|
|
for x in _RANGE_1000:
|
|
s_upper()
|
|
|
|
@bench('("where in the world is carmen san deigo?"*10).upper()',
|
|
"case conversion -- dense", 1000)
|
|
def upper_conversion_dense(STR):
|
|
s = STR("where in the world is carmen san deigo?"*10)
|
|
s_upper = s.upper
|
|
for x in _RANGE_1000:
|
|
s_upper()
|
|
|
|
|
|
# end of benchmarks
|
|
|
|
#################
|
|
|
|
class BenchTimer(timeit.Timer):
|
|
def best(self, repeat=1):
|
|
for i in range(1, 10):
|
|
number = 10**i
|
|
x = self.timeit(number)
|
|
if x > 0.02:
|
|
break
|
|
times = [x]
|
|
for i in range(1, repeat):
|
|
times.append(self.timeit(number))
|
|
return min(times) / number
|
|
|
|
def main():
|
|
(options, test_names) = parser.parse_args()
|
|
if options.bytes_only and options.unicode_only:
|
|
raise SystemExit("Only one of --8-bit and --unicode are allowed")
|
|
|
|
bench_functions = []
|
|
for (k,v) in globals().items():
|
|
if hasattr(v, "is_bench"):
|
|
if test_names:
|
|
for name in test_names:
|
|
if name in v.group:
|
|
break
|
|
else:
|
|
# Not selected, ignore
|
|
continue
|
|
if options.skip_re and hasattr(v, "uses_re"):
|
|
continue
|
|
|
|
bench_functions.append( (v.group, k, v) )
|
|
bench_functions.sort()
|
|
|
|
p("bytes\tunicode")
|
|
p("(in ms)\t(in ms)\t%\tcomment")
|
|
|
|
bytes_total = uni_total = 0.0
|
|
|
|
for title, group in itertools.groupby(bench_functions,
|
|
operator.itemgetter(0)):
|
|
# Flush buffer before each group
|
|
sys.stdout.flush()
|
|
p("="*10, title)
|
|
for (_, k, v) in group:
|
|
if hasattr(v, "is_bench"):
|
|
bytes_time = 0.0
|
|
bytes_time_s = " - "
|
|
if not options.unicode_only:
|
|
try:
|
|
bytes_time = BenchTimer("__main__.%s(__main__.BYTES)" % (k,),
|
|
"import __main__").best(REPEAT)
|
|
bytes_time_s = "%.2f" % (1000 * bytes_time)
|
|
bytes_total += bytes_time
|
|
except UnsupportedType:
|
|
bytes_time_s = "N/A"
|
|
uni_time = 0.0
|
|
uni_time_s = " - "
|
|
if not options.bytes_only:
|
|
try:
|
|
uni_time = BenchTimer("__main__.%s(__main__.UNICODE)" % (k,),
|
|
"import __main__").best(REPEAT)
|
|
uni_time_s = "%.2f" % (1000 * uni_time)
|
|
uni_total += uni_time
|
|
except UnsupportedType:
|
|
uni_time_s = "N/A"
|
|
try:
|
|
average = bytes_time/uni_time
|
|
except (TypeError, ZeroDivisionError):
|
|
average = 0.0
|
|
p("%s\t%s\t%.1f\t%s (*%d)" % (
|
|
bytes_time_s, uni_time_s, 100.*average,
|
|
v.comment, v.repeat_count))
|
|
|
|
if bytes_total == uni_total == 0.0:
|
|
p("That was zippy!")
|
|
else:
|
|
try:
|
|
ratio = bytes_total/uni_total
|
|
except ZeroDivisionError:
|
|
ratio = 0.0
|
|
p("%.2f\t%.2f\t%.1f\t%s" % (
|
|
1000*bytes_total, 1000*uni_total, 100.*ratio,
|
|
"TOTAL"))
|
|
|
|
if __name__ == "__main__":
|
|
main()
|