mirror of
				https://github.com/python/cpython.git
				synced 2025-10-31 13:41:24 +00:00 
			
		
		
		
	 5482db5800
			
		
	
	
		5482db5800
		
			
		
	
	
	
	
		
			
			Co-authored-by: Terry Jan Reedy <tjreedy@udel.edu>
Co-authored-by: Serhiy Storchaka <storchaka@gmail.com>
Co-authored-by: Łukasz Langa <lukasz@langa.pl>.
(cherry picked from commit 8f943ca257)
Co-authored-by: Mohamad Mansour <66031317+mohamadmansourX@users.noreply.github.com>
		
	
			
		
			
				
	
	
		
			1482 lines
		
	
	
	
		
			43 KiB
		
	
	
	
		
			Python
		
	
	
	
	
	
			
		
		
	
	
			1482 lines
		
	
	
	
		
			43 KiB
		
	
	
	
		
			Python
		
	
	
	
	
	
| 
 | |
| # Various microbenchmarks comparing unicode and byte string performance
 | |
| # Please keep this file both 2.x and 3.x compatible!
 | |
| 
 | |
| import timeit
 | |
| import itertools
 | |
| import operator
 | |
| import re
 | |
| import sys
 | |
| import datetime
 | |
| import optparse
 | |
| 
 | |
| VERSION = '2.0'
 | |
| 
 | |
| def p(*args):
 | |
|     sys.stdout.write(' '.join(str(s) for s in args) + '\n')
 | |
| 
 | |
| if sys.version_info >= (3,):
 | |
|     BYTES = bytes_from_str = lambda x: x.encode('ascii')
 | |
|     UNICODE = unicode_from_str = lambda x: x
 | |
| else:
 | |
|     BYTES = bytes_from_str = lambda x: x
 | |
|     UNICODE = unicode_from_str = lambda x: x.decode('ascii')
 | |
| 
 | |
| class UnsupportedType(TypeError):
 | |
|     pass
 | |
| 
 | |
| 
 | |
| p('stringbench v%s' % VERSION)
 | |
| p(sys.version)
 | |
| p(datetime.datetime.now())
 | |
| 
 | |
| REPEAT = 1
 | |
| REPEAT = 3
 | |
| #REPEAT = 7
 | |
| 
 | |
| if __name__ != "__main__":
 | |
|     raise SystemExit("Must run as main program")
 | |
| 
 | |
| parser = optparse.OptionParser()
 | |
| parser.add_option("-R", "--skip-re", dest="skip_re",
 | |
|                   action="store_true",
 | |
|                   help="skip regular expression tests")
 | |
| parser.add_option("-8", "--8-bit", dest="bytes_only",
 | |
|                   action="store_true",
 | |
|                   help="only do 8-bit string benchmarks")
 | |
| parser.add_option("-u", "--unicode", dest="unicode_only",
 | |
|                   action="store_true",
 | |
|                   help="only do Unicode string benchmarks")
 | |
| 
 | |
| 
 | |
| _RANGE_1000 = list(range(1000))
 | |
| _RANGE_100 = list(range(100))
 | |
| _RANGE_10 = list(range(10))
 | |
| 
 | |
| dups = {}
 | |
| def bench(s, group, repeat_count):
 | |
|     def blah(f):
 | |
|         if f.__name__ in dups:
 | |
|             raise AssertionError("Multiple functions with same name: %r" %
 | |
|                                  (f.__name__,))
 | |
|         dups[f.__name__] = 1
 | |
|         f.comment = s
 | |
|         f.is_bench = True
 | |
|         f.group = group
 | |
|         f.repeat_count = repeat_count
 | |
|         return f
 | |
|     return blah
 | |
| 
 | |
| def uses_re(f):
 | |
|     f.uses_re = True
 | |
| 
 | |
| ####### 'in' comparisons
 | |
| 
 | |
| @bench('"A" in "A"*1000', "early match, single character", 1000)
 | |
| def in_test_quick_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("A")
 | |
|     for x in _RANGE_1000:
 | |
|         s2 in s1
 | |
| 
 | |
| @bench('"B" in "A"*1000', "no match, single character", 1000)
 | |
| def in_test_no_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("B")
 | |
|     for x in _RANGE_1000:
 | |
|         s2 in s1
 | |
| 
 | |
| 
 | |
| @bench('"AB" in "AB"*1000', "early match, two characters", 1000)
 | |
| def in_test_quick_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("AB")
 | |
|     for x in _RANGE_1000:
 | |
|         s2 in s1
 | |
| 
 | |
| @bench('"BC" in "AB"*1000', "no match, two characters", 1000)
 | |
| def in_test_no_match_two_character(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("BC")
 | |
|     for x in _RANGE_1000:
 | |
|         s2 in s1
 | |
| 
 | |
| @bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000)
 | |
| def in_test_slow_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 300+"C")
 | |
|     s2 = STR("BC")
 | |
|     for x in _RANGE_1000:
 | |
|         s2 in s1
 | |
| 
 | |
| @bench('s="ABC"*33; (s+"E") in ((s+"D")*300+s+"E")',
 | |
|        "late match, 100 characters", 100)
 | |
| def in_test_slow_match_100_characters(STR):
 | |
|     m = STR("ABC"*33)
 | |
|     d = STR("D")
 | |
|     e = STR("E")
 | |
|     s1 = (m+d)*300 + m+e
 | |
|     s2 = m+e
 | |
|     for x in _RANGE_100:
 | |
|         s2 in s1
 | |
| 
 | |
| # Try with regex
 | |
| @uses_re
 | |
| @bench('s="ABC"*33; re.compile(s+"D").search((s+"D")*300+s+"E")',
 | |
|        "late match, 100 characters", 100)
 | |
| def re_test_slow_match_100_characters(STR):
 | |
|     m = STR("ABC"*33)
 | |
|     d = STR("D")
 | |
|     e = STR("E")
 | |
|     s1 = (m+d)*300 + m+e
 | |
|     s2 = m+e
 | |
|     pat = re.compile(s2)
 | |
|     search = pat.search
 | |
|     for x in _RANGE_100:
 | |
|         search(s1)
 | |
| 
 | |
| 
 | |
| #### same tests as 'in' but use 'find'
 | |
| 
 | |
| @bench('("A"*1000).find("A")', "early match, single character", 1000)
 | |
| def find_test_quick_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("A")
 | |
|     s1_find = s1.find
 | |
|     for x in _RANGE_1000:
 | |
|         s1_find(s2)
 | |
| 
 | |
| @bench('("A"*1000).find("B")', "no match, single character", 1000)
 | |
| def find_test_no_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("B")
 | |
|     s1_find = s1.find
 | |
|     for x in _RANGE_1000:
 | |
|         s1_find(s2)
 | |
| 
 | |
| 
 | |
| @bench('("AB"*1000).find("AB")', "early match, two characters", 1000)
 | |
| def find_test_quick_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("AB")
 | |
|     s1_find = s1.find
 | |
|     for x in _RANGE_1000:
 | |
|         s1_find(s2)
 | |
| 
 | |
| @bench('("AB"*1000).find("BC")', "no match, two characters", 1000)
 | |
| def find_test_no_match_two_character(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("BC")
 | |
|     s1_find = s1.find
 | |
|     for x in _RANGE_1000:
 | |
|         s1_find(s2)
 | |
| 
 | |
| @bench('("AB"*1000).find("CA")', "no match, two characters", 1000)
 | |
| def find_test_no_match_two_character_bis(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("CA")
 | |
|     s1_find = s1.find
 | |
|     for x in _RANGE_1000:
 | |
|         s1_find(s2)
 | |
| 
 | |
| @bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000)
 | |
| def find_test_slow_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 300+"C")
 | |
|     s2 = STR("BC")
 | |
|     s1_find = s1.find
 | |
|     for x in _RANGE_1000:
 | |
|         s1_find(s2)
 | |
| 
 | |
| @bench('("AB"*300+"CA").find("CA")', "late match, two characters", 1000)
 | |
| def find_test_slow_match_two_characters_bis(STR):
 | |
|     s1 = STR("AB" * 300+"CA")
 | |
|     s2 = STR("CA")
 | |
|     s1_find = s1.find
 | |
|     for x in _RANGE_1000:
 | |
|         s1_find(s2)
 | |
| 
 | |
| @bench('s="ABC"*33; ((s+"D")*500+s+"E").find(s+"E")',
 | |
|        "late match, 100 characters", 100)
 | |
| def find_test_slow_match_100_characters(STR):
 | |
|     m = STR("ABC"*33)
 | |
|     d = STR("D")
 | |
|     e = STR("E")
 | |
|     s1 = (m+d)*500 + m+e
 | |
|     s2 = m+e
 | |
|     s1_find = s1.find
 | |
|     for x in _RANGE_100:
 | |
|         s1_find(s2)
 | |
| 
 | |
| @bench('s="ABC"*33; ((s+"D")*500+"E"+s).find("E"+s)',
 | |
|        "late match, 100 characters", 100)
 | |
| def find_test_slow_match_100_characters_bis(STR):
 | |
|     m = STR("ABC"*33)
 | |
|     d = STR("D")
 | |
|     e = STR("E")
 | |
|     s1 = (m+d)*500 + e+m
 | |
|     s2 = e+m
 | |
|     s1_find = s1.find
 | |
|     for x in _RANGE_100:
 | |
|         s1_find(s2)
 | |
| 
 | |
| 
 | |
| #### Same tests for 'rfind'
 | |
| 
 | |
| @bench('("A"*1000).rfind("A")', "early match, single character", 1000)
 | |
| def rfind_test_quick_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("A")
 | |
|     s1_rfind = s1.rfind
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rfind(s2)
 | |
| 
 | |
| @bench('("A"*1000).rfind("B")', "no match, single character", 1000)
 | |
| def rfind_test_no_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("B")
 | |
|     s1_rfind = s1.rfind
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rfind(s2)
 | |
| 
 | |
| 
 | |
| @bench('("AB"*1000).rfind("AB")', "early match, two characters", 1000)
 | |
| def rfind_test_quick_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("AB")
 | |
|     s1_rfind = s1.rfind
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rfind(s2)
 | |
| 
 | |
| @bench('("AB"*1000).rfind("BC")', "no match, two characters", 1000)
 | |
| def rfind_test_no_match_two_character(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("BC")
 | |
|     s1_rfind = s1.rfind
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rfind(s2)
 | |
| 
 | |
| @bench('("AB"*1000).rfind("CA")', "no match, two characters", 1000)
 | |
| def rfind_test_no_match_two_character_bis(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("CA")
 | |
|     s1_rfind = s1.rfind
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rfind(s2)
 | |
| 
 | |
| @bench('("C"+"AB"*300).rfind("CA")', "late match, two characters", 1000)
 | |
| def rfind_test_slow_match_two_characters(STR):
 | |
|     s1 = STR("C" + "AB" * 300)
 | |
|     s2 = STR("CA")
 | |
|     s1_rfind = s1.rfind
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rfind(s2)
 | |
| 
 | |
| @bench('("BC"+"AB"*300).rfind("BC")', "late match, two characters", 1000)
 | |
| def rfind_test_slow_match_two_characters_bis(STR):
 | |
|     s1 = STR("BC" + "AB" * 300)
 | |
|     s2 = STR("BC")
 | |
|     s1_rfind = s1.rfind
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rfind(s2)
 | |
| 
 | |
| @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rfind("E"+s)',
 | |
|        "late match, 100 characters", 100)
 | |
| def rfind_test_slow_match_100_characters(STR):
 | |
|     m = STR("ABC"*33)
 | |
|     d = STR("D")
 | |
|     e = STR("E")
 | |
|     s1 = e+m + (d+m)*500
 | |
|     s2 = e+m
 | |
|     s1_rfind = s1.rfind
 | |
|     for x in _RANGE_100:
 | |
|         s1_rfind(s2)
 | |
| 
 | |
| @bench('s="ABC"*33; (s+"E"+("D"+s)*500).rfind(s+"E")',
 | |
|        "late match, 100 characters", 100)
 | |
| def rfind_test_slow_match_100_characters_bis(STR):
 | |
|     m = STR("ABC"*33)
 | |
|     d = STR("D")
 | |
|     e = STR("E")
 | |
|     s1 = m+e + (d+m)*500
 | |
|     s2 = m+e
 | |
|     s1_rfind = s1.rfind
 | |
|     for x in _RANGE_100:
 | |
|         s1_rfind(s2)
 | |
| 
 | |
| 
 | |
| #### Now with index.
 | |
| # Skip the ones which fail because that would include exception overhead.
 | |
| 
 | |
| @bench('("A"*1000).index("A")', "early match, single character", 1000)
 | |
| def index_test_quick_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("A")
 | |
|     s1_index = s1.index
 | |
|     for x in _RANGE_1000:
 | |
|         s1_index(s2)
 | |
| 
 | |
| @bench('("AB"*1000).index("AB")', "early match, two characters", 1000)
 | |
| def index_test_quick_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("AB")
 | |
|     s1_index = s1.index
 | |
|     for x in _RANGE_1000:
 | |
|         s1_index(s2)
 | |
| 
 | |
| @bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000)
 | |
| def index_test_slow_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 300+"C")
 | |
|     s2 = STR("BC")
 | |
|     s1_index = s1.index
 | |
|     for x in _RANGE_1000:
 | |
|         s1_index(s2)
 | |
| 
 | |
| @bench('s="ABC"*33; ((s+"D")*500+s+"E").index(s+"E")',
 | |
|        "late match, 100 characters", 100)
 | |
| def index_test_slow_match_100_characters(STR):
 | |
|     m = STR("ABC"*33)
 | |
|     d = STR("D")
 | |
|     e = STR("E")
 | |
|     s1 = (m+d)*500 + m+e
 | |
|     s2 = m+e
 | |
|     s1_index = s1.index
 | |
|     for x in _RANGE_100:
 | |
|         s1_index(s2)
 | |
| 
 | |
| 
 | |
| #### Same for rindex
 | |
| 
 | |
| @bench('("A"*1000).rindex("A")', "early match, single character", 1000)
 | |
| def rindex_test_quick_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("A")
 | |
|     s1_rindex = s1.rindex
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rindex(s2)
 | |
| 
 | |
| @bench('("AB"*1000).rindex("AB")', "early match, two characters", 1000)
 | |
| def rindex_test_quick_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("AB")
 | |
|     s1_rindex = s1.rindex
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rindex(s2)
 | |
| 
 | |
| @bench('("C"+"AB"*300).rindex("CA")', "late match, two characters", 1000)
 | |
| def rindex_test_slow_match_two_characters(STR):
 | |
|     s1 = STR("C" + "AB" * 300)
 | |
|     s2 = STR("CA")
 | |
|     s1_rindex = s1.rindex
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rindex(s2)
 | |
| 
 | |
| @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rindex("E"+s)',
 | |
|        "late match, 100 characters", 100)
 | |
| def rindex_test_slow_match_100_characters(STR):
 | |
|     m = STR("ABC"*33)
 | |
|     d = STR("D")
 | |
|     e = STR("E")
 | |
|     s1 = e + m + (d+m)*500
 | |
|     s2 = e + m
 | |
|     s1_rindex = s1.rindex
 | |
|     for x in _RANGE_100:
 | |
|         s1_rindex(s2)
 | |
| 
 | |
| 
 | |
| #### Same for partition
 | |
| 
 | |
| @bench('("A"*1000).partition("A")', "early match, single character", 1000)
 | |
| def partition_test_quick_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("A")
 | |
|     s1_partition = s1.partition
 | |
|     for x in _RANGE_1000:
 | |
|         s1_partition(s2)
 | |
| 
 | |
| @bench('("A"*1000).partition("B")', "no match, single character", 1000)
 | |
| def partition_test_no_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("B")
 | |
|     s1_partition = s1.partition
 | |
|     for x in _RANGE_1000:
 | |
|         s1_partition(s2)
 | |
| 
 | |
| 
 | |
| @bench('("AB"*1000).partition("AB")', "early match, two characters", 1000)
 | |
| def partition_test_quick_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("AB")
 | |
|     s1_partition = s1.partition
 | |
|     for x in _RANGE_1000:
 | |
|         s1_partition(s2)
 | |
| 
 | |
| @bench('("AB"*1000).partition("BC")', "no match, two characters", 1000)
 | |
| def partition_test_no_match_two_character(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("BC")
 | |
|     s1_partition = s1.partition
 | |
|     for x in _RANGE_1000:
 | |
|         s1_partition(s2)
 | |
| 
 | |
| @bench('("AB"*300+"C").partition("BC")', "late match, two characters", 1000)
 | |
| def partition_test_slow_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 300+"C")
 | |
|     s2 = STR("BC")
 | |
|     s1_partition = s1.partition
 | |
|     for x in _RANGE_1000:
 | |
|         s1_partition(s2)
 | |
| 
 | |
| @bench('s="ABC"*33; ((s+"D")*500+s+"E").partition(s+"E")',
 | |
|        "late match, 100 characters", 100)
 | |
| def partition_test_slow_match_100_characters(STR):
 | |
|     m = STR("ABC"*33)
 | |
|     d = STR("D")
 | |
|     e = STR("E")
 | |
|     s1 = (m+d)*500 + m+e
 | |
|     s2 = m+e
 | |
|     s1_partition = s1.partition
 | |
|     for x in _RANGE_100:
 | |
|         s1_partition(s2)
 | |
| 
 | |
| 
 | |
| #### Same for rpartition
 | |
| 
 | |
| @bench('("A"*1000).rpartition("A")', "early match, single character", 1000)
 | |
| def rpartition_test_quick_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("A")
 | |
|     s1_rpartition = s1.rpartition
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rpartition(s2)
 | |
| 
 | |
| @bench('("A"*1000).rpartition("B")', "no match, single character", 1000)
 | |
| def rpartition_test_no_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("B")
 | |
|     s1_rpartition = s1.rpartition
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rpartition(s2)
 | |
| 
 | |
| 
 | |
| @bench('("AB"*1000).rpartition("AB")', "early match, two characters", 1000)
 | |
| def rpartition_test_quick_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("AB")
 | |
|     s1_rpartition = s1.rpartition
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rpartition(s2)
 | |
| 
 | |
| @bench('("AB"*1000).rpartition("BC")', "no match, two characters", 1000)
 | |
| def rpartition_test_no_match_two_character(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("BC")
 | |
|     s1_rpartition = s1.rpartition
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rpartition(s2)
 | |
| 
 | |
| @bench('("C"+"AB"*300).rpartition("CA")', "late match, two characters", 1000)
 | |
| def rpartition_test_slow_match_two_characters(STR):
 | |
|     s1 = STR("C" + "AB" * 300)
 | |
|     s2 = STR("CA")
 | |
|     s1_rpartition = s1.rpartition
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rpartition(s2)
 | |
| 
 | |
| @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rpartition("E"+s)',
 | |
|        "late match, 100 characters", 100)
 | |
| def rpartition_test_slow_match_100_characters(STR):
 | |
|     m = STR("ABC"*33)
 | |
|     d = STR("D")
 | |
|     e = STR("E")
 | |
|     s1 = e + m + (d+m)*500
 | |
|     s2 = e + m
 | |
|     s1_rpartition = s1.rpartition
 | |
|     for x in _RANGE_100:
 | |
|         s1_rpartition(s2)
 | |
| 
 | |
| 
 | |
| #### Same for split(s, 1)
 | |
| 
 | |
| @bench('("A"*1000).split("A", 1)', "early match, single character", 1000)
 | |
| def split_test_quick_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("A")
 | |
|     s1_split = s1.split
 | |
|     for x in _RANGE_1000:
 | |
|         s1_split(s2, 1)
 | |
| 
 | |
| @bench('("A"*1000).split("B", 1)', "no match, single character", 1000)
 | |
| def split_test_no_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("B")
 | |
|     s1_split = s1.split
 | |
|     for x in _RANGE_1000:
 | |
|         s1_split(s2, 1)
 | |
| 
 | |
| 
 | |
| @bench('("AB"*1000).split("AB", 1)', "early match, two characters", 1000)
 | |
| def split_test_quick_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("AB")
 | |
|     s1_split = s1.split
 | |
|     for x in _RANGE_1000:
 | |
|         s1_split(s2, 1)
 | |
| 
 | |
| @bench('("AB"*1000).split("BC", 1)', "no match, two characters", 1000)
 | |
| def split_test_no_match_two_character(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("BC")
 | |
|     s1_split = s1.split
 | |
|     for x in _RANGE_1000:
 | |
|         s1_split(s2, 1)
 | |
| 
 | |
| @bench('("AB"*300+"C").split("BC", 1)', "late match, two characters", 1000)
 | |
| def split_test_slow_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 300+"C")
 | |
|     s2 = STR("BC")
 | |
|     s1_split = s1.split
 | |
|     for x in _RANGE_1000:
 | |
|         s1_split(s2, 1)
 | |
| 
 | |
| @bench('s="ABC"*33; ((s+"D")*500+s+"E").split(s+"E", 1)',
 | |
|        "late match, 100 characters", 100)
 | |
| def split_test_slow_match_100_characters(STR):
 | |
|     m = STR("ABC"*33)
 | |
|     d = STR("D")
 | |
|     e = STR("E")
 | |
|     s1 = (m+d)*500 + m+e
 | |
|     s2 = m+e
 | |
|     s1_split = s1.split
 | |
|     for x in _RANGE_100:
 | |
|         s1_split(s2, 1)
 | |
| 
 | |
| 
 | |
| #### Same for rsplit(s, 1)
 | |
| 
 | |
| @bench('("A"*1000).rsplit("A", 1)', "early match, single character", 1000)
 | |
| def rsplit_test_quick_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("A")
 | |
|     s1_rsplit = s1.rsplit
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rsplit(s2, 1)
 | |
| 
 | |
| @bench('("A"*1000).rsplit("B", 1)', "no match, single character", 1000)
 | |
| def rsplit_test_no_match_single_character(STR):
 | |
|     s1 = STR("A" * 1000)
 | |
|     s2 = STR("B")
 | |
|     s1_rsplit = s1.rsplit
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rsplit(s2, 1)
 | |
| 
 | |
| 
 | |
| @bench('("AB"*1000).rsplit("AB", 1)', "early match, two characters", 1000)
 | |
| def rsplit_test_quick_match_two_characters(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("AB")
 | |
|     s1_rsplit = s1.rsplit
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rsplit(s2, 1)
 | |
| 
 | |
| @bench('("AB"*1000).rsplit("BC", 1)', "no match, two characters", 1000)
 | |
| def rsplit_test_no_match_two_character(STR):
 | |
|     s1 = STR("AB" * 1000)
 | |
|     s2 = STR("BC")
 | |
|     s1_rsplit = s1.rsplit
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rsplit(s2, 1)
 | |
| 
 | |
| @bench('("C"+"AB"*300).rsplit("CA", 1)', "late match, two characters", 1000)
 | |
| def rsplit_test_slow_match_two_characters(STR):
 | |
|     s1 = STR("C" + "AB" * 300)
 | |
|     s2 = STR("CA")
 | |
|     s1_rsplit = s1.rsplit
 | |
|     for x in _RANGE_1000:
 | |
|         s1_rsplit(s2, 1)
 | |
| 
 | |
| @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rsplit("E"+s, 1)',
 | |
|        "late match, 100 characters", 100)
 | |
| def rsplit_test_slow_match_100_characters(STR):
 | |
|     m = STR("ABC"*33)
 | |
|     d = STR("D")
 | |
|     e = STR("E")
 | |
|     s1 = e + m + (d+m)*500
 | |
|     s2 = e + m
 | |
|     s1_rsplit = s1.rsplit
 | |
|     for x in _RANGE_100:
 | |
|         s1_rsplit(s2, 1)
 | |
| 
 | |
| 
 | |
| #### Benchmark the operator-based methods
 | |
| 
 | |
| @bench('"A"*10', "repeat 1 character 10 times", 1000)
 | |
| def repeat_single_10_times(STR):
 | |
|     s = STR("A")
 | |
|     for x in _RANGE_1000:
 | |
|         s * 10
 | |
| 
 | |
| @bench('"A"*1000', "repeat 1 character 1000 times", 1000)
 | |
| def repeat_single_1000_times(STR):
 | |
|     s = STR("A")
 | |
|     for x in _RANGE_1000:
 | |
|         s * 1000
 | |
| 
 | |
| @bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000)
 | |
| def repeat_5_10_times(STR):
 | |
|     s = STR("ABCDE")
 | |
|     for x in _RANGE_1000:
 | |
|         s * 10
 | |
| 
 | |
| @bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000)
 | |
| def repeat_5_1000_times(STR):
 | |
|     s = STR("ABCDE")
 | |
|     for x in _RANGE_1000:
 | |
|         s * 1000
 | |
| 
 | |
| # + for concat
 | |
| 
 | |
| @bench('"Andrew"+"Dalke"', "concat two strings", 1000)
 | |
| def concat_two_strings(STR):
 | |
|     s1 = STR("Andrew")
 | |
|     s2 = STR("Dalke")
 | |
|     for x in _RANGE_1000:
 | |
|         s1+s2
 | |
| 
 | |
| @bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15",
 | |
|        1000)
 | |
| def concat_many_strings(STR):
 | |
|     s1=STR('TIXSGYNREDCVBHJ')
 | |
|     s2=STR('PUMTLXBZVDO')
 | |
|     s3=STR('FVZNJ')
 | |
|     s4=STR('OGDXUW')
 | |
|     s5=STR('WEIMRNCOYVGHKB')
 | |
|     s6=STR('FCQTNMXPUZH')
 | |
|     s7=STR('TICZJYRLBNVUEAK')
 | |
|     s8=STR('REYB')
 | |
|     s9=STR('PWUOQ')
 | |
|     s10=STR('EQHCMKBS')
 | |
|     s11=STR('AEVDFOH')
 | |
|     s12=STR('IFHVD')
 | |
|     s13=STR('JGTCNLXWOHQ')
 | |
|     s14=STR('ITSKEPYLROZAWXF')
 | |
|     s15=STR('THEK')
 | |
|     s16=STR('GHPZFBUYCKMNJIT')
 | |
|     s17=STR('JMUZ')
 | |
|     s18=STR('WLZQMTB')
 | |
|     s19=STR('KPADCBW')
 | |
|     s20=STR('TNJHZQAGBU')
 | |
|     for x in _RANGE_1000:
 | |
|         (s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+
 | |
|          s11+s12+s13+s14+s15+s16+s17+s18+s19+s20)
 | |
| 
 | |
| 
 | |
| #### Benchmark join
 | |
| 
 | |
| def get_bytes_yielding_seq(STR, arg):
 | |
|     if STR is BYTES and sys.version_info >= (3,):
 | |
|         raise UnsupportedType
 | |
|     return STR(arg)
 | |
| 
 | |
| @bench('"A".join("")',
 | |
|        "join empty string, with 1 character sep", 100)
 | |
| def join_empty_single(STR):
 | |
|     sep = STR("A")
 | |
|     s2 = get_bytes_yielding_seq(STR, "")
 | |
|     sep_join = sep.join
 | |
|     for x in _RANGE_100:
 | |
|         sep_join(s2)
 | |
| 
 | |
| @bench('"ABCDE".join("")',
 | |
|        "join empty string, with 5 character sep", 100)
 | |
| def join_empty_5(STR):
 | |
|     sep = STR("ABCDE")
 | |
|     s2 = get_bytes_yielding_seq(STR, "")
 | |
|     sep_join = sep.join
 | |
|     for x in _RANGE_100:
 | |
|         sep_join(s2)
 | |
| 
 | |
| @bench('"A".join("ABC..Z")',
 | |
|        "join string with 26 characters, with 1 character sep", 1000)
 | |
| def join_alphabet_single(STR):
 | |
|     sep = STR("A")
 | |
|     s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ")
 | |
|     sep_join = sep.join
 | |
|     for x in _RANGE_1000:
 | |
|         sep_join(s2)
 | |
| 
 | |
| @bench('"ABCDE".join("ABC..Z")',
 | |
|        "join string with 26 characters, with 5 character sep", 1000)
 | |
| def join_alphabet_5(STR):
 | |
|     sep = STR("ABCDE")
 | |
|     s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ")
 | |
|     sep_join = sep.join
 | |
|     for x in _RANGE_1000:
 | |
|         sep_join(s2)
 | |
| 
 | |
| @bench('"A".join(list("ABC..Z"))',
 | |
|        "join list of 26 characters, with 1 character sep", 1000)
 | |
| def join_alphabet_list_single(STR):
 | |
|     sep = STR("A")
 | |
|     s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"]
 | |
|     sep_join = sep.join
 | |
|     for x in _RANGE_1000:
 | |
|         sep_join(s2)
 | |
| 
 | |
| @bench('"ABCDE".join(list("ABC..Z"))',
 | |
|        "join list of 26 characters, with 5 character sep", 1000)
 | |
| def join_alphabet_list_five(STR):
 | |
|     sep = STR("ABCDE")
 | |
|     s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"]
 | |
|     sep_join = sep.join
 | |
|     for x in _RANGE_1000:
 | |
|         sep_join(s2)
 | |
| 
 | |
| @bench('"A".join(["Bob"]*100)',
 | |
|        "join list of 100 words, with 1 character sep", 1000)
 | |
| def join_100_words_single(STR):
 | |
|     sep = STR("A")
 | |
|     s2 = [STR("Bob")]*100
 | |
|     sep_join = sep.join
 | |
|     for x in _RANGE_1000:
 | |
|         sep_join(s2)
 | |
| 
 | |
| @bench('"ABCDE".join(["Bob"]*100))',
 | |
|        "join list of 100 words, with 5 character sep", 1000)
 | |
| def join_100_words_5(STR):
 | |
|     sep = STR("ABCDE")
 | |
|     s2 = [STR("Bob")]*100
 | |
|     sep_join = sep.join
 | |
|     for x in _RANGE_1000:
 | |
|         sep_join(s2)
 | |
| 
 | |
| #### split tests
 | |
| 
 | |
| @bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000)
 | |
| def whitespace_split(STR):
 | |
|     s = STR("Here are some words. "*2)
 | |
|     s_split = s.split
 | |
|     for x in _RANGE_1000:
 | |
|         s_split()
 | |
| 
 | |
| @bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000)
 | |
| def whitespace_rsplit(STR):
 | |
|     s = STR("Here are some words. "*2)
 | |
|     s_rsplit = s.rsplit
 | |
|     for x in _RANGE_1000:
 | |
|         s_rsplit()
 | |
| 
 | |
| @bench('("Here are some words. "*2).split(None, 1)',
 | |
|        "split 1 whitespace", 1000)
 | |
| def whitespace_split_1(STR):
 | |
|     s = STR("Here are some words. "*2)
 | |
|     s_split = s.split
 | |
|     N = None
 | |
|     for x in _RANGE_1000:
 | |
|         s_split(N, 1)
 | |
| 
 | |
| @bench('("Here are some words. "*2).rsplit(None, 1)',
 | |
|        "split 1 whitespace", 1000)
 | |
| def whitespace_rsplit_1(STR):
 | |
|     s = STR("Here are some words. "*2)
 | |
|     s_rsplit = s.rsplit
 | |
|     N = None
 | |
|     for x in _RANGE_1000:
 | |
|         s_rsplit(N, 1)
 | |
| 
 | |
| @bench('("Here are some words. "*2).partition(" ")',
 | |
|        "split 1 whitespace", 1000)
 | |
| def whitespace_partition(STR):
 | |
|     sep = STR(" ")
 | |
|     s = STR("Here are some words. "*2)
 | |
|     s_partition = s.partition
 | |
|     for x in _RANGE_1000:
 | |
|         s_partition(sep)
 | |
| 
 | |
| @bench('("Here are some words. "*2).rpartition(" ")',
 | |
|        "split 1 whitespace", 1000)
 | |
| def whitespace_rpartition(STR):
 | |
|     sep = STR(" ")
 | |
|     s = STR("Here are some words. "*2)
 | |
|     s_rpartition = s.rpartition
 | |
|     for x in _RANGE_1000:
 | |
|         s_rpartition(sep)
 | |
| 
 | |
| human_text = """\
 | |
| Python is a dynamic object-oriented programming language that can be
 | |
| used for many kinds of software development. It offers strong support
 | |
| for integration with other languages and tools, comes with extensive
 | |
| standard libraries, and can be learned in a few days. Many Python
 | |
| programmers report substantial productivity gains and feel the language
 | |
| encourages the development of higher quality, more maintainable code.
 | |
| 
 | |
| Python runs on Windows, Linux/Unix, Mac OS X, Amiga, Palm
 | |
| Handhelds, and Nokia mobile phones. Python has also been ported to the
 | |
| Java and .NET virtual machines.
 | |
| 
 | |
| Python is distributed under an OSI-approved open source license that
 | |
| makes it free to use, even for commercial products.
 | |
| """*25
 | |
| human_text_bytes = bytes_from_str(human_text)
 | |
| human_text_unicode = unicode_from_str(human_text)
 | |
| def _get_human_text(STR):
 | |
|     if STR is UNICODE:
 | |
|         return human_text_unicode
 | |
|     if STR is BYTES:
 | |
|         return human_text_bytes
 | |
|     raise AssertionError
 | |
| 
 | |
| @bench('human_text.split()', "split whitespace (huge)", 10)
 | |
| def whitespace_split_huge(STR):
 | |
|     s = _get_human_text(STR)
 | |
|     s_split = s.split
 | |
|     for x in _RANGE_10:
 | |
|         s_split()
 | |
| 
 | |
| @bench('human_text.rsplit()', "split whitespace (huge)", 10)
 | |
| def whitespace_rsplit_huge(STR):
 | |
|     s = _get_human_text(STR)
 | |
|     s_rsplit = s.rsplit
 | |
|     for x in _RANGE_10:
 | |
|         s_rsplit()
 | |
| 
 | |
| 
 | |
| 
 | |
| @bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000)
 | |
| def newlines_split(STR):
 | |
|     s = STR("this\nis\na\ntest\n")
 | |
|     s_split = s.split
 | |
|     nl = STR("\n")
 | |
|     for x in _RANGE_1000:
 | |
|         s_split(nl)
 | |
| 
 | |
| 
 | |
| @bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000)
 | |
| def newlines_rsplit(STR):
 | |
|     s = STR("this\nis\na\ntest\n")
 | |
|     s_rsplit = s.rsplit
 | |
|     nl = STR("\n")
 | |
|     for x in _RANGE_1000:
 | |
|         s_rsplit(nl)
 | |
| 
 | |
| @bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000)
 | |
| def newlines_splitlines(STR):
 | |
|     s = STR("this\nis\na\ntest\n")
 | |
|     s_splitlines = s.splitlines
 | |
|     for x in _RANGE_1000:
 | |
|         s_splitlines()
 | |
| 
 | |
| ## split text with 2000 newlines
 | |
| 
 | |
| def _make_2000_lines():
 | |
|     import random
 | |
|     r = random.Random(100)
 | |
|     chars = list(map(chr, range(32, 128)))
 | |
|     i = 0
 | |
|     while i < len(chars):
 | |
|         chars[i] = " "
 | |
|         i += r.randrange(9)
 | |
|     s = "".join(chars)
 | |
|     s = s*4
 | |
|     words = []
 | |
|     for i in range(2000):
 | |
|         start = r.randrange(96)
 | |
|         n = r.randint(5, 65)
 | |
|         words.append(s[start:start+n])
 | |
|     return "\n".join(words)+"\n"
 | |
| 
 | |
| _text_with_2000_lines = _make_2000_lines()
 | |
| _text_with_2000_lines_bytes = bytes_from_str(_text_with_2000_lines)
 | |
| _text_with_2000_lines_unicode = unicode_from_str(_text_with_2000_lines)
 | |
| def _get_2000_lines(STR):
 | |
|     if STR is UNICODE:
 | |
|         return _text_with_2000_lines_unicode
 | |
|     if STR is BYTES:
 | |
|         return _text_with_2000_lines_bytes
 | |
|     raise AssertionError
 | |
| 
 | |
| 
 | |
| @bench('"...text...".split("\\n")', "split 2000 newlines", 10)
 | |
| def newlines_split_2000(STR):
 | |
|     s = _get_2000_lines(STR)
 | |
|     s_split = s.split
 | |
|     nl = STR("\n")
 | |
|     for x in _RANGE_10:
 | |
|         s_split(nl)
 | |
| 
 | |
| @bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10)
 | |
| def newlines_rsplit_2000(STR):
 | |
|     s = _get_2000_lines(STR)
 | |
|     s_rsplit = s.rsplit
 | |
|     nl = STR("\n")
 | |
|     for x in _RANGE_10:
 | |
|         s_rsplit(nl)
 | |
| 
 | |
| @bench('"...text...".splitlines()', "split 2000 newlines", 10)
 | |
| def newlines_splitlines_2000(STR):
 | |
|     s = _get_2000_lines(STR)
 | |
|     s_splitlines = s.splitlines
 | |
|     for x in _RANGE_10:
 | |
|         s_splitlines()
 | |
| 
 | |
| 
 | |
| ## split text on "--" characters
 | |
| @bench(
 | |
|     '"this--is--a--test--of--the--emergency--broadcast--system".split("--")',
 | |
|     "split on multicharacter separator (small)", 1000)
 | |
| def split_multichar_sep_small(STR):
 | |
|     s = STR("this--is--a--test--of--the--emergency--broadcast--system")
 | |
|     s_split = s.split
 | |
|     pat = STR("--")
 | |
|     for x in _RANGE_1000:
 | |
|         s_split(pat)
 | |
| @bench(
 | |
|     '"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")',
 | |
|     "split on multicharacter separator (small)", 1000)
 | |
| def rsplit_multichar_sep_small(STR):
 | |
|     s = STR("this--is--a--test--of--the--emergency--broadcast--system")
 | |
|     s_rsplit = s.rsplit
 | |
|     pat = STR("--")
 | |
|     for x in _RANGE_1000:
 | |
|         s_rsplit(pat)
 | |
| 
 | |
| ## split dna text on "ACTAT" characters
 | |
| @bench('dna.split("ACTAT")',
 | |
|        "split on multicharacter separator (dna)", 10)
 | |
| def split_multichar_sep_dna(STR):
 | |
|     s = _get_dna(STR)
 | |
|     s_split = s.split
 | |
|     pat = STR("ACTAT")
 | |
|     for x in _RANGE_10:
 | |
|         s_split(pat)
 | |
| 
 | |
| @bench('dna.rsplit("ACTAT")',
 | |
|        "split on multicharacter separator (dna)", 10)
 | |
| def rsplit_multichar_sep_dna(STR):
 | |
|     s = _get_dna(STR)
 | |
|     s_rsplit = s.rsplit
 | |
|     pat = STR("ACTAT")
 | |
|     for x in _RANGE_10:
 | |
|         s_rsplit(pat)
 | |
| 
 | |
| 
 | |
| 
 | |
| ## split with limits
 | |
| 
 | |
| GFF3_example = "\t".join([
 | |
|     "I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".",
 | |
|     "ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"])
 | |
| 
 | |
| @bench('GFF3_example.split("\\t")', "tab split", 1000)
 | |
| def tab_split_no_limit(STR):
 | |
|     sep = STR("\t")
 | |
|     s = STR(GFF3_example)
 | |
|     s_split = s.split
 | |
|     for x in _RANGE_1000:
 | |
|         s_split(sep)
 | |
| 
 | |
| @bench('GFF3_example.split("\\t", 8)', "tab split", 1000)
 | |
| def tab_split_limit(STR):
 | |
|     sep = STR("\t")
 | |
|     s = STR(GFF3_example)
 | |
|     s_split = s.split
 | |
|     for x in _RANGE_1000:
 | |
|         s_split(sep, 8)
 | |
| 
 | |
| @bench('GFF3_example.rsplit("\\t")', "tab split", 1000)
 | |
| def tab_rsplit_no_limit(STR):
 | |
|     sep = STR("\t")
 | |
|     s = STR(GFF3_example)
 | |
|     s_rsplit = s.rsplit
 | |
|     for x in _RANGE_1000:
 | |
|         s_rsplit(sep)
 | |
| 
 | |
| @bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000)
 | |
| def tab_rsplit_limit(STR):
 | |
|     sep = STR("\t")
 | |
|     s = STR(GFF3_example)
 | |
|     s_rsplit = s.rsplit
 | |
|     for x in _RANGE_1000:
 | |
|         s_rsplit(sep, 8)
 | |
| 
 | |
| #### Count characters
 | |
| 
 | |
| @bench('...text.with.2000.newlines.count("\\n")',
 | |
|        "count newlines", 10)
 | |
| def count_newlines(STR):
 | |
|     s = _get_2000_lines(STR)
 | |
|     s_count = s.count
 | |
|     nl = STR("\n")
 | |
|     for x in _RANGE_10:
 | |
|         s_count(nl)
 | |
| 
 | |
| # Orchid sequences concatenated, from Biopython
 | |
| _dna = """
 | |
| CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT
 | |
| AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG
 | |
| AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT
 | |
| TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC
 | |
| AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG
 | |
| TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT
 | |
| CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
 | |
| TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT
 | |
| GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC
 | |
| TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG
 | |
| GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA
 | |
| ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC
 | |
| CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA
 | |
| ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA
 | |
| ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA
 | |
| TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG
 | |
| CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG
 | |
| GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA
 | |
| ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG
 | |
| ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC
 | |
| ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA
 | |
| GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA
 | |
| TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG
 | |
| TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT
 | |
| TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG
 | |
| GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG
 | |
| GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT
 | |
| AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC
 | |
| GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG
 | |
| TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT
 | |
| CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA
 | |
| TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC
 | |
| TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC
 | |
| AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT
 | |
| GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT
 | |
| GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA
 | |
| CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG
 | |
| GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA
 | |
| TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG
 | |
| ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT
 | |
| GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA
 | |
| AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC
 | |
| AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA
 | |
| ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC
 | |
| GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC
 | |
| GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC
 | |
| AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA
 | |
| GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG
 | |
| ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC
 | |
| GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC
 | |
| """
 | |
| _dna = "".join(_dna.splitlines())
 | |
| _dna = _dna * 25
 | |
| _dna_bytes = bytes_from_str(_dna)
 | |
| _dna_unicode = unicode_from_str(_dna)
 | |
| 
 | |
| def _get_dna(STR):
 | |
|     if STR is UNICODE:
 | |
|         return _dna_unicode
 | |
|     if STR is BYTES:
 | |
|         return _dna_bytes
 | |
|     raise AssertionError
 | |
| 
 | |
| @bench('dna.count("AACT")', "count AACT substrings in DNA example", 10)
 | |
| def count_aact(STR):
 | |
|     seq = _get_dna(STR)
 | |
|     seq_count = seq.count
 | |
|     needle = STR("AACT")
 | |
|     for x in _RANGE_10:
 | |
|         seq_count(needle)
 | |
| 
 | |
| ##### startswith and endswith
 | |
| 
 | |
| @bench('"Andrew".startswith("A")', 'startswith single character', 1000)
 | |
| def startswith_single(STR):
 | |
|     s1 = STR("Andrew")
 | |
|     s2 = STR("A")
 | |
|     s1_startswith = s1.startswith
 | |
|     for x in _RANGE_1000:
 | |
|         s1_startswith(s2)
 | |
| 
 | |
| @bench('"Andrew".startswith("Andrew")', 'startswith multiple characters',
 | |
|        1000)
 | |
| def startswith_multiple(STR):
 | |
|     s1 = STR("Andrew")
 | |
|     s2 = STR("Andrew")
 | |
|     s1_startswith = s1.startswith
 | |
|     for x in _RANGE_1000:
 | |
|         s1_startswith(s2)
 | |
| 
 | |
| @bench('"Andrew".startswith("Anders")',
 | |
|        'startswith multiple characters - not!', 1000)
 | |
| def startswith_multiple_not(STR):
 | |
|     s1 = STR("Andrew")
 | |
|     s2 = STR("Anders")
 | |
|     s1_startswith = s1.startswith
 | |
|     for x in _RANGE_1000:
 | |
|         s1_startswith(s2)
 | |
| 
 | |
| 
 | |
| # endswith
 | |
| 
 | |
| @bench('"Andrew".endswith("w")', 'endswith single character', 1000)
 | |
| def endswith_single(STR):
 | |
|     s1 = STR("Andrew")
 | |
|     s2 = STR("w")
 | |
|     s1_endswith = s1.endswith
 | |
|     for x in _RANGE_1000:
 | |
|         s1_endswith(s2)
 | |
| 
 | |
| @bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000)
 | |
| def endswith_multiple(STR):
 | |
|     s1 = STR("Andrew")
 | |
|     s2 = STR("Andrew")
 | |
|     s1_endswith = s1.endswith
 | |
|     for x in _RANGE_1000:
 | |
|         s1_endswith(s2)
 | |
| 
 | |
| @bench('"Andrew".endswith("Anders")',
 | |
|        'endswith multiple characters - not!', 1000)
 | |
| def endswith_multiple_not(STR):
 | |
|     s1 = STR("Andrew")
 | |
|     s2 = STR("Anders")
 | |
|     s1_endswith = s1.endswith
 | |
|     for x in _RANGE_1000:
 | |
|         s1_endswith(s2)
 | |
| 
 | |
| #### Strip
 | |
| 
 | |
| @bench('"Hello!\\n".strip()', 'strip terminal newline', 1000)
 | |
| def terminal_newline_strip_right(STR):
 | |
|     s = STR("Hello!\n")
 | |
|     s_strip = s.strip
 | |
|     for x in _RANGE_1000:
 | |
|         s_strip()
 | |
| 
 | |
| @bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000)
 | |
| def terminal_newline_rstrip(STR):
 | |
|     s = STR("Hello!\n")
 | |
|     s_rstrip = s.rstrip
 | |
|     for x in _RANGE_1000:
 | |
|         s_rstrip()
 | |
| 
 | |
| @bench('"\\nHello!".strip()', 'strip terminal newline', 1000)
 | |
| def terminal_newline_strip_left(STR):
 | |
|     s = STR("\nHello!")
 | |
|     s_strip = s.strip
 | |
|     for x in _RANGE_1000:
 | |
|         s_strip()
 | |
| 
 | |
| @bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000)
 | |
| def terminal_newline_strip_both(STR):
 | |
|     s = STR("\nHello!\n")
 | |
|     s_strip = s.strip
 | |
|     for x in _RANGE_1000:
 | |
|         s_strip()
 | |
| 
 | |
| @bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000)
 | |
| def terminal_newline_lstrip(STR):
 | |
|     s = STR("\nHello!")
 | |
|     s_lstrip = s.lstrip
 | |
|     for x in _RANGE_1000:
 | |
|         s_lstrip()
 | |
| 
 | |
| @bench('s="Hello!\\n"; s[:-1] if s[-1]=="\\n" else s',
 | |
|        'strip terminal newline', 1000)
 | |
| def terminal_newline_if_else(STR):
 | |
|     s = STR("Hello!\n")
 | |
|     NL = STR("\n")
 | |
|     for x in _RANGE_1000:
 | |
|         s[:-1] if (s[-1] == NL) else s
 | |
| 
 | |
| 
 | |
| # Strip multiple spaces or tabs
 | |
| 
 | |
| @bench('"Hello\\t   \\t".strip()', 'strip terminal spaces and tabs', 1000)
 | |
| def terminal_space_strip(STR):
 | |
|     s = STR("Hello\t   \t!")
 | |
|     s_strip = s.strip
 | |
|     for x in _RANGE_1000:
 | |
|         s_strip()
 | |
| 
 | |
| @bench('"Hello\\t   \\t".rstrip()', 'strip terminal spaces and tabs', 1000)
 | |
| def terminal_space_rstrip(STR):
 | |
|     s = STR("Hello!\t   \t")
 | |
|     s_rstrip = s.rstrip
 | |
|     for x in _RANGE_1000:
 | |
|         s_rstrip()
 | |
| 
 | |
| @bench('"\\t   \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000)
 | |
| def terminal_space_lstrip(STR):
 | |
|     s = STR("\t   \tHello!")
 | |
|     s_lstrip = s.lstrip
 | |
|     for x in _RANGE_1000:
 | |
|         s_lstrip()
 | |
| 
 | |
| 
 | |
| #### replace
 | |
| @bench('"This is a test".replace(" ", "\\t")', 'replace single character',
 | |
|        1000)
 | |
| def replace_single_character(STR):
 | |
|     s = STR("This is a test!")
 | |
|     from_str = STR(" ")
 | |
|     to_str = STR("\t")
 | |
|     s_replace = s.replace
 | |
|     for x in _RANGE_1000:
 | |
|         s_replace(from_str, to_str)
 | |
| 
 | |
| @uses_re
 | |
| @bench('re.sub(" ", "\\t", "This is a test"', 'replace single character',
 | |
|        1000)
 | |
| def replace_single_character_re(STR):
 | |
|     s = STR("This is a test!")
 | |
|     pat = re.compile(STR(" "))
 | |
|     to_str = STR("\t")
 | |
|     pat_sub = pat.sub
 | |
|     for x in _RANGE_1000:
 | |
|         pat_sub(to_str, s)
 | |
| 
 | |
| @bench('"...text.with.2000.lines...replace("\\n", " ")',
 | |
|        'replace single character, big string', 10)
 | |
| def replace_single_character_big(STR):
 | |
|     s = _get_2000_lines(STR)
 | |
|     from_str = STR("\n")
 | |
|     to_str = STR(" ")
 | |
|     s_replace = s.replace
 | |
|     for x in _RANGE_10:
 | |
|         s_replace(from_str, to_str)
 | |
| 
 | |
| @uses_re
 | |
| @bench('re.sub("\\n", " ", "...text.with.2000.lines...")',
 | |
|        'replace single character, big string', 10)
 | |
| def replace_single_character_big_re(STR):
 | |
|     s = _get_2000_lines(STR)
 | |
|     pat = re.compile(STR("\n"))
 | |
|     to_str = STR(" ")
 | |
|     pat_sub = pat.sub
 | |
|     for x in _RANGE_10:
 | |
|         pat_sub(to_str, s)
 | |
| 
 | |
| 
 | |
| @bench('dna.replace("ATC", "ATT")',
 | |
|        'replace multiple characters, dna', 10)
 | |
| def replace_multiple_characters_dna(STR):
 | |
|     seq = _get_dna(STR)
 | |
|     from_str = STR("ATC")
 | |
|     to_str = STR("ATT")
 | |
|     seq_replace = seq.replace
 | |
|     for x in _RANGE_10:
 | |
|         seq_replace(from_str, to_str)
 | |
| 
 | |
| # This increases the character count
 | |
| @bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")',
 | |
|        'replace and expand multiple characters, big string', 10)
 | |
| def replace_multiple_character_big(STR):
 | |
|     s = _get_2000_lines(STR)
 | |
|     from_str = STR("\n")
 | |
|     to_str = STR("\r\n")
 | |
|     s_replace = s.replace
 | |
|     for x in _RANGE_10:
 | |
|         s_replace(from_str, to_str)
 | |
| 
 | |
| 
 | |
| # This decreases the character count
 | |
| @bench('"When shall we three meet again?".replace("ee", "")',
 | |
|        'replace/remove multiple characters', 1000)
 | |
| def replace_multiple_character_remove(STR):
 | |
|     s = STR("When shall we three meet again?")
 | |
|     from_str = STR("ee")
 | |
|     to_str = STR("")
 | |
|     s_replace = s.replace
 | |
|     for x in _RANGE_1000:
 | |
|         s_replace(from_str, to_str)
 | |
| 
 | |
| 
 | |
| big_s = "A" + ("Z"*128*1024)
 | |
| big_s_bytes = bytes_from_str(big_s)
 | |
| big_s_unicode = unicode_from_str(big_s)
 | |
| def _get_big_s(STR):
 | |
|     if STR is UNICODE: return big_s_unicode
 | |
|     if STR is BYTES: return big_s_bytes
 | |
|     raise AssertionError
 | |
| 
 | |
| # The older replace implementation counted all matches in
 | |
| # the string even when it only needed to make one replacement.
 | |
| @bench('("A" + ("Z"*128*1024)).replace("A", "BB", 1)',
 | |
|        'quick replace single character match', 10)
 | |
| def quick_replace_single_match(STR):
 | |
|     s = _get_big_s(STR)
 | |
|     from_str = STR("A")
 | |
|     to_str = STR("BB")
 | |
|     s_replace = s.replace
 | |
|     for x in _RANGE_10:
 | |
|         s_replace(from_str, to_str, 1)
 | |
| 
 | |
| @bench('("A" + ("Z"*128*1024)).replace("AZZ", "BBZZ", 1)',
 | |
|        'quick replace multiple character match', 10)
 | |
| def quick_replace_multiple_match(STR):
 | |
|     s = _get_big_s(STR)
 | |
|     from_str = STR("AZZ")
 | |
|     to_str = STR("BBZZ")
 | |
|     s_replace = s.replace
 | |
|     for x in _RANGE_10:
 | |
|         s_replace(from_str, to_str, 1)
 | |
| 
 | |
| 
 | |
| ####
 | |
| 
 | |
| # CCP does a lot of this, for internationalisation of ingame messages.
 | |
| _format = "The %(thing)s is %(place)s the %(location)s."
 | |
| _format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", }
 | |
| _format_bytes = bytes_from_str(_format)
 | |
| _format_unicode = unicode_from_str(_format)
 | |
| _format_dict_bytes = dict((bytes_from_str(k), bytes_from_str(v)) for (k,v) in _format_dict.items())
 | |
| _format_dict_unicode = dict((unicode_from_str(k), unicode_from_str(v)) for (k,v) in _format_dict.items())
 | |
| 
 | |
| def _get_format(STR):
 | |
|     if STR is UNICODE:
 | |
|         return _format_unicode
 | |
|     if STR is BYTES:
 | |
|         if sys.version_info >= (3,):
 | |
|             raise UnsupportedType
 | |
|         return _format_bytes
 | |
|     raise AssertionError
 | |
| 
 | |
| def _get_format_dict(STR):
 | |
|     if STR is UNICODE:
 | |
|         return _format_dict_unicode
 | |
|     if STR is BYTES:
 | |
|         if sys.version_info >= (3,):
 | |
|             raise UnsupportedType
 | |
|         return _format_dict_bytes
 | |
|     raise AssertionError
 | |
| 
 | |
| # Formatting.
 | |
| @bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}',
 | |
|        'formatting a string type with a dict', 1000)
 | |
| def format_with_dict(STR):
 | |
|     s = _get_format(STR)
 | |
|     d = _get_format_dict(STR)
 | |
|     for x in _RANGE_1000:
 | |
|         s % d
 | |
| 
 | |
| 
 | |
| #### Upper- and lower- case conversion
 | |
| 
 | |
| @bench('("Where in the world is Carmen San Deigo?"*10).lower()',
 | |
|        "case conversion -- rare", 1000)
 | |
| def lower_conversion_rare(STR):
 | |
|     s = STR("Where in the world is Carmen San Deigo?"*10)
 | |
|     s_lower = s.lower
 | |
|     for x in _RANGE_1000:
 | |
|         s_lower()
 | |
| 
 | |
| @bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()',
 | |
|        "case conversion -- dense", 1000)
 | |
| def lower_conversion_dense(STR):
 | |
|     s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10)
 | |
|     s_lower = s.lower
 | |
|     for x in _RANGE_1000:
 | |
|         s_lower()
 | |
| 
 | |
| 
 | |
| @bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()',
 | |
|        "case conversion -- rare", 1000)
 | |
| def upper_conversion_rare(STR):
 | |
|     s = STR("Where in the world is Carmen San Deigo?"*10)
 | |
|     s_upper = s.upper
 | |
|     for x in _RANGE_1000:
 | |
|         s_upper()
 | |
| 
 | |
| @bench('("where in the world is carmen san deigo?"*10).upper()',
 | |
|        "case conversion -- dense", 1000)
 | |
| def upper_conversion_dense(STR):
 | |
|     s = STR("where in the world is carmen san deigo?"*10)
 | |
|     s_upper = s.upper
 | |
|     for x in _RANGE_1000:
 | |
|         s_upper()
 | |
| 
 | |
| 
 | |
| # end of benchmarks
 | |
| 
 | |
| #################
 | |
| 
 | |
| class BenchTimer(timeit.Timer):
 | |
|     def best(self, repeat=1):
 | |
|         for i in range(1, 10):
 | |
|             number = 10**i
 | |
|             x = self.timeit(number)
 | |
|             if x > 0.02:
 | |
|                 break
 | |
|         times = [x]
 | |
|         for i in range(1, repeat):
 | |
|             times.append(self.timeit(number))
 | |
|         return min(times) / number
 | |
| 
 | |
| def main():
 | |
|     (options, test_names) = parser.parse_args()
 | |
|     if options.bytes_only and options.unicode_only:
 | |
|         raise SystemExit("Only one of --8-bit and --unicode are allowed")
 | |
| 
 | |
|     bench_functions = []
 | |
|     for (k,v) in globals().items():
 | |
|         if hasattr(v, "is_bench"):
 | |
|             if test_names:
 | |
|                 for name in test_names:
 | |
|                     if name in v.group:
 | |
|                         break
 | |
|                 else:
 | |
|                     # Not selected, ignore
 | |
|                     continue
 | |
|             if options.skip_re and hasattr(v, "uses_re"):
 | |
|                 continue
 | |
| 
 | |
|             bench_functions.append( (v.group, k, v) )
 | |
|     bench_functions.sort()
 | |
| 
 | |
|     p("bytes\tunicode")
 | |
|     p("(in ms)\t(in ms)\t%\tcomment")
 | |
| 
 | |
|     bytes_total = uni_total = 0.0
 | |
| 
 | |
|     for title, group in itertools.groupby(bench_functions,
 | |
|                                       operator.itemgetter(0)):
 | |
|         # Flush buffer before each group
 | |
|         sys.stdout.flush()
 | |
|         p("="*10, title)
 | |
|         for (_, k, v) in group:
 | |
|             if hasattr(v, "is_bench"):
 | |
|                 bytes_time = 0.0
 | |
|                 bytes_time_s = " - "
 | |
|                 if not options.unicode_only:
 | |
|                     try:
 | |
|                         bytes_time = BenchTimer("__main__.%s(__main__.BYTES)" % (k,),
 | |
|                                                 "import __main__").best(REPEAT)
 | |
|                         bytes_time_s = "%.2f" % (1000 * bytes_time)
 | |
|                         bytes_total += bytes_time
 | |
|                     except UnsupportedType:
 | |
|                         bytes_time_s = "N/A"
 | |
|                 uni_time = 0.0
 | |
|                 uni_time_s = " - "
 | |
|                 if not options.bytes_only:
 | |
|                     try:
 | |
|                         uni_time = BenchTimer("__main__.%s(__main__.UNICODE)" % (k,),
 | |
|                                               "import __main__").best(REPEAT)
 | |
|                         uni_time_s = "%.2f" % (1000 * uni_time)
 | |
|                         uni_total += uni_time
 | |
|                     except UnsupportedType:
 | |
|                         uni_time_s = "N/A"
 | |
|                 try:
 | |
|                     average = bytes_time/uni_time
 | |
|                 except (TypeError, ZeroDivisionError):
 | |
|                     average = 0.0
 | |
|                 p("%s\t%s\t%.1f\t%s (*%d)" % (
 | |
|                     bytes_time_s, uni_time_s, 100.*average,
 | |
|                     v.comment, v.repeat_count))
 | |
| 
 | |
|     if bytes_total == uni_total == 0.0:
 | |
|         p("That was zippy!")
 | |
|     else:
 | |
|         try:
 | |
|             ratio = bytes_total/uni_total
 | |
|         except ZeroDivisionError:
 | |
|             ratio = 0.0
 | |
|         p("%.2f\t%.2f\t%.1f\t%s" % (
 | |
|             1000*bytes_total, 1000*uni_total, 100.*ratio,
 | |
|             "TOTAL"))
 | |
| 
 | |
| if __name__ == "__main__":
 | |
|     main()
 |