Stowage/go
2
0
Fork 0
mirror of https://github.com/golang/go.git synced 2025-12-08 06:10:04 +00:00
Code Issues Projects Releases Packages Wiki Activity

clean up the code a bit

Browse source 
start a log of progress

R=rsc
DELTA=222  (185 added, 17 deleted, 20 changed)
OCL=32701
CL=32718
This commit is contained in:
Rob Pike 2009-08-04 10:13:58 -07:00
parent 9155bb3345
commit 417683c3d3
3 changed files with 205 additions and 37 deletions
Download patch file Download diff file Expand all files Collapse all files

58
test/bench/fasta.go
View file

@ -49,7 +49,7 @@ var out *bufio.Writer
var n = flag.Int("n", 1000, "length of result")
const WIDTH = 60
const WIDTH = 60 // Fold lines after WIDTH bytes
func min(a, b int) int {
if a < b {
@ -65,6 +65,7 @@ type AminoAcid struct {
var lastrandom uint32 = 42
// Random number between 0.0 and 1.0
func myrandom() float {
const (
IM = 139968;
@ -77,24 +78,22 @@ func myrandom() float {
}
func AccumulateProbabilities(genelist []AminoAcid) {
cp := 0.0;
for i := 0; i < len(genelist); i++ {
cp += genelist[i].p;
genelist[i].p = cp;
for i := 1; i < len(genelist); i++ {
genelist[i].p += genelist[i-1].p;
}
}
/* This function prints the characters of the string s. When it */
/* reaches the end of the string, it goes back to the beginning */
/* It stops when the total number of characters printed is count. */
/* Between each WIDTH consecutive characters it prints a newline */
/* This function assumes that WIDTH <= strlen (s) + 1 */
// RepeatFasta prints the characters of the byte slice s. When it
// reaches the end of the slice, it goes back to the beginning.
// It stops after generating count characters.
// After each WIDTH characters it prints a newline.
// It assumes that WIDTH <= len(s) + 1.
func RepeatFasta(s []byte, count int) {
pos := 0;
s2 := make([]byte, len(s) + WIDTH);
bytes.Copy(s2, s);
bytes.Copy(s2[len(s):len(s2)], s);
for {
for count > 0 {
line := min(WIDTH, count);
out.Write(s2[pos:pos+line]);
out.WriteByte('\n');
@ -103,43 +102,31 @@ func RepeatFasta(s []byte, count int) {
pos -= len(s);
}
count -= line;
if count <= 0 {
break
}
}
}
/* This function takes a pointer to the first element of an array */
/* Each element of the array is a struct with a character and */
/* a float number p between 0 and 1. */
/* The function generates a random float number r and */
/* finds the first array element such that p >= r. */
/* This is a weighted random selection. */
/* The function then prints the character of the array element. */
/* This is done count times. */
/* Between each WIDTH consecutive characters, the function prints a newline */
// Each element of genelist is a struct with a character and
// a floating point number p between 0 and 1.
// RandomFasta generates a random float r and
// finds the first element such that p >= r.
// This is a weighted random selection.
// RandomFasta then prints the character of the array element.
// This sequence is repeated count times.
// Between each WIDTH consecutive characters, the function prints a newline.
func RandomFasta(genelist []AminoAcid, count int) {
buf := make([]byte, WIDTH + 1);
for {
for count > 0 {
line := min(WIDTH, count);
pos := 0;
for {
for pos := 0; pos < line; pos++ {
r := myrandom();
var i int;
for i = 0; genelist[i].p < r; i++ {
}
buf[pos] = genelist[i].c;
pos++;
if pos >= line {
break
}
}
buf[line] = '\n';
out.Write(buf[0:line + 1]);
count -= line;
if count <= 0 {
break
}
}
}
@ -177,7 +164,7 @@ func main() {
AccumulateProbabilities(iub);
AccumulateProbabilities(homosapiens);
alu := strings.Bytes(""
alu := strings.Bytes(
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
@ -188,11 +175,8 @@ func main() {
out.WriteString(">ONE Homo sapiens alu\n");
RepeatFasta(alu, 2 * *n);
out.Flush();
out.WriteString(">TWO IUB ambiguity codes\n");
RandomFasta(iub, 3 * *n);
out.Flush();
out.WriteString(">THREE Homo sapiens frequency\n");
RandomFasta(homosapiens, 5 * *n);
out.Flush();
}