mirror of
https://github.com/golang/go.git
synced 2025-12-08 06:10:04 +00:00
1) Change default gofmt default settings for
parsing and printing to new syntax. Use -oldparser to parse the old syntax, use -oldprinter to print the old syntax. 2) Change default gofmt formatting settings to use tabs for indentation only and to use spaces for alignment. This will make the code alignment insensitive to an editor's tabwidth. Use -spaces=false to use tabs for alignment. 3) Manually changed src/exp/parser/parser_test.go so that it doesn't try to parse the parser's source files using the old syntax (they have new syntax now). 4) gofmt -w src misc test/bench 5th and last set of files. R=rsc CC=golang-dev https://golang.org/cl/180050
This commit is contained in:
parent
d65a5cce89
commit
45ca9f7a9e
59 changed files with 5907 additions and 5907 deletions
|
|
@ -38,28 +38,28 @@ POSSIBILITY OF SUCH DAMAGE.
|
|||
package main
|
||||
|
||||
import (
|
||||
"bufio";
|
||||
"flag";
|
||||
"os";
|
||||
"strings";
|
||||
"bufio"
|
||||
"flag"
|
||||
"os"
|
||||
"strings"
|
||||
)
|
||||
|
||||
var out *bufio.Writer
|
||||
|
||||
var n = flag.Int("n", 1000, "length of result")
|
||||
|
||||
const WIDTH = 60 // Fold lines after WIDTH bytes
|
||||
const WIDTH = 60 // Fold lines after WIDTH bytes
|
||||
|
||||
func min(a, b int) int {
|
||||
if a < b {
|
||||
return a
|
||||
}
|
||||
return b;
|
||||
return b
|
||||
}
|
||||
|
||||
type AminoAcid struct {
|
||||
p float;
|
||||
c byte;
|
||||
p float
|
||||
c byte
|
||||
}
|
||||
|
||||
func AccumulateProbabilities(genelist []AminoAcid) {
|
||||
|
|
@ -74,28 +74,28 @@ func AccumulateProbabilities(genelist []AminoAcid) {
|
|||
// After each WIDTH characters it prints a newline.
|
||||
// It assumes that WIDTH <= len(s) + 1.
|
||||
func RepeatFasta(s []byte, count int) {
|
||||
pos := 0;
|
||||
s2 := make([]byte, len(s)+WIDTH);
|
||||
copy(s2, s);
|
||||
copy(s2[len(s):], s);
|
||||
pos := 0
|
||||
s2 := make([]byte, len(s)+WIDTH)
|
||||
copy(s2, s)
|
||||
copy(s2[len(s):], s)
|
||||
for count > 0 {
|
||||
line := min(WIDTH, count);
|
||||
out.Write(s2[pos : pos+line]);
|
||||
out.WriteByte('\n');
|
||||
pos += line;
|
||||
line := min(WIDTH, count)
|
||||
out.Write(s2[pos : pos+line])
|
||||
out.WriteByte('\n')
|
||||
pos += line
|
||||
if pos >= len(s) {
|
||||
pos -= len(s)
|
||||
}
|
||||
count -= line;
|
||||
count -= line
|
||||
}
|
||||
}
|
||||
|
||||
var lastrandom uint32 = 42
|
||||
|
||||
const (
|
||||
IM = 139968;
|
||||
IA = 3877;
|
||||
IC = 29573;
|
||||
IM = 139968
|
||||
IA = 3877
|
||||
IC = 29573
|
||||
)
|
||||
|
||||
// Each element of genelist is a struct with a character and
|
||||
|
|
@ -107,31 +107,31 @@ const (
|
|||
// This sequence is repeated count times.
|
||||
// Between each WIDTH consecutive characters, the function prints a newline.
|
||||
func RandomFasta(genelist []AminoAcid, count int) {
|
||||
buf := make([]byte, WIDTH+1);
|
||||
buf := make([]byte, WIDTH+1)
|
||||
for count > 0 {
|
||||
line := min(WIDTH, count);
|
||||
line := min(WIDTH, count)
|
||||
for pos := 0; pos < line; pos++ {
|
||||
lastrandom = (lastrandom*IA + IC) % IM;
|
||||
lastrandom = (lastrandom*IA + IC) % IM
|
||||
// Integer to float conversions are faster if the integer is signed.
|
||||
r := float(int32(lastrandom)) / IM;
|
||||
r := float(int32(lastrandom)) / IM
|
||||
for _, v := range genelist {
|
||||
if v.p >= r {
|
||||
buf[pos] = v.c;
|
||||
break;
|
||||
buf[pos] = v.c
|
||||
break
|
||||
}
|
||||
}
|
||||
}
|
||||
buf[line] = '\n';
|
||||
out.Write(buf[0 : line+1]);
|
||||
count -= line;
|
||||
buf[line] = '\n'
|
||||
out.Write(buf[0 : line+1])
|
||||
count -= line
|
||||
}
|
||||
}
|
||||
|
||||
func main() {
|
||||
out = bufio.NewWriter(os.Stdout);
|
||||
defer out.Flush();
|
||||
out = bufio.NewWriter(os.Stdout)
|
||||
defer out.Flush()
|
||||
|
||||
flag.Parse();
|
||||
flag.Parse()
|
||||
|
||||
iub := []AminoAcid{
|
||||
AminoAcid{0.27, 'a'},
|
||||
|
|
@ -149,17 +149,17 @@ func main() {
|
|||
AminoAcid{0.02, 'V'},
|
||||
AminoAcid{0.02, 'W'},
|
||||
AminoAcid{0.02, 'Y'},
|
||||
};
|
||||
}
|
||||
|
||||
homosapiens := []AminoAcid{
|
||||
AminoAcid{0.3029549426680, 'a'},
|
||||
AminoAcid{0.1979883004921, 'c'},
|
||||
AminoAcid{0.1975473066391, 'g'},
|
||||
AminoAcid{0.3015094502008, 't'},
|
||||
};
|
||||
}
|
||||
|
||||
AccumulateProbabilities(iub);
|
||||
AccumulateProbabilities(homosapiens);
|
||||
AccumulateProbabilities(iub)
|
||||
AccumulateProbabilities(homosapiens)
|
||||
|
||||
alu := strings.Bytes(
|
||||
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
|
||||
|
|
@ -168,12 +168,12 @@ func main() {
|
|||
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
|
||||
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
|
||||
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
|
||||
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA");
|
||||
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")
|
||||
|
||||
out.WriteString(">ONE Homo sapiens alu\n");
|
||||
RepeatFasta(alu, 2**n);
|
||||
out.WriteString(">TWO IUB ambiguity codes\n");
|
||||
RandomFasta(iub, 3**n);
|
||||
out.WriteString(">THREE Homo sapiens frequency\n");
|
||||
RandomFasta(homosapiens, 5**n);
|
||||
out.WriteString(">ONE Homo sapiens alu\n")
|
||||
RepeatFasta(alu, 2**n)
|
||||
out.WriteString(">TWO IUB ambiguity codes\n")
|
||||
RandomFasta(iub, 3**n)
|
||||
out.WriteString(">THREE Homo sapiens frequency\n")
|
||||
RandomFasta(homosapiens, 5**n)
|
||||
}
|
||||
|
|
|
|||
Loading…
Add table
Add a link
Reference in a new issue