1) Change default gofmt default settings for

parsing and printing to new syntax.

   Use -oldparser to parse the old syntax,
   use -oldprinter to print the old syntax.

2) Change default gofmt formatting settings
   to use tabs for indentation only and to use
   spaces for alignment. This will make the code
   alignment insensitive to an editor's tabwidth.

   Use -spaces=false to use tabs for alignment.

3) Manually changed src/exp/parser/parser_test.go
   so that it doesn't try to parse the parser's
   source files using the old syntax (they have
   new syntax now).

4) gofmt -w src misc test/bench

5th and last set of files.

R=rsc
CC=golang-dev
https://golang.org/cl/180050

test/bench/fasta.go

@@ -38,28 +38,28 @@ POSSIBILITY OF SUCH DAMAGE.
 package main
 
 import (
-	"bufio";
-	"flag";
-	"os";
-	"strings";
+	"bufio"
+	"flag"
+	"os"
+	"strings"
 )
 
 var out *bufio.Writer
 
 var n = flag.Int("n", 1000, "length of result")
 
-const WIDTH = 60	// Fold lines after WIDTH bytes
+const WIDTH = 60 // Fold lines after WIDTH bytes
 
 func min(a, b int) int {
 	if a < b {
 		return a
 	}
-	return b;
+	return b
 }
 
 type AminoAcid struct {
-	p	float;
-	c	byte;
+	p float
+	c byte
 }
 
 func AccumulateProbabilities(genelist []AminoAcid) {
@@ -74,28 +74,28 @@ func AccumulateProbabilities(genelist []AminoAcid) {
 // After each WIDTH characters it prints a newline.
 // It assumes that WIDTH <= len(s) + 1.
 func RepeatFasta(s []byte, count int) {
-	pos := 0;
-	s2 := make([]byte, len(s)+WIDTH);
-	copy(s2, s);
-	copy(s2[len(s):], s);
+	pos := 0
+	s2 := make([]byte, len(s)+WIDTH)
+	copy(s2, s)
+	copy(s2[len(s):], s)
 	for count > 0 {
-		line := min(WIDTH, count);
-		out.Write(s2[pos : pos+line]);
-		out.WriteByte('\n');
-		pos += line;
+		line := min(WIDTH, count)
+		out.Write(s2[pos : pos+line])
+		out.WriteByte('\n')
+		pos += line
 		if pos >= len(s) {
 			pos -= len(s)
 		}
-		count -= line;
+		count -= line
 	}
 }
 
 var lastrandom uint32 = 42
 
 const (
-	IM	= 139968;
-	IA	= 3877;
-	IC	= 29573;
+	IM = 139968
+	IA = 3877
+	IC = 29573
 )
 
 // Each element of genelist is a struct with a character and
@@ -107,31 +107,31 @@ const (
 // This sequence is repeated count times.
 // Between each WIDTH consecutive characters, the function prints a newline.
 func RandomFasta(genelist []AminoAcid, count int) {
-	buf := make([]byte, WIDTH+1);
+	buf := make([]byte, WIDTH+1)
 	for count > 0 {
-		line := min(WIDTH, count);
+		line := min(WIDTH, count)
 		for pos := 0; pos < line; pos++ {
-			lastrandom = (lastrandom*IA + IC) % IM;
+			lastrandom = (lastrandom*IA + IC) % IM
 			// Integer to float conversions are faster if the integer is signed.
-			r := float(int32(lastrandom)) / IM;
+			r := float(int32(lastrandom)) / IM
 			for _, v := range genelist {
 				if v.p >= r {
-					buf[pos] = v.c;
-					break;
+					buf[pos] = v.c
+					break
 				}
 			}
 		}
-		buf[line] = '\n';
-		out.Write(buf[0 : line+1]);
-		count -= line;
+		buf[line] = '\n'
+		out.Write(buf[0 : line+1])
+		count -= line
 	}
 }
 
 func main() {
-	out = bufio.NewWriter(os.Stdout);
-	defer out.Flush();
+	out = bufio.NewWriter(os.Stdout)
+	defer out.Flush()
 
-	flag.Parse();
+	flag.Parse()
 
 	iub := []AminoAcid{
 		AminoAcid{0.27, 'a'},
@@ -149,17 +149,17 @@ func main() {
 		AminoAcid{0.02, 'V'},
 		AminoAcid{0.02, 'W'},
 		AminoAcid{0.02, 'Y'},
-	};
+	}
 
 	homosapiens := []AminoAcid{
 		AminoAcid{0.3029549426680, 'a'},
 		AminoAcid{0.1979883004921, 'c'},
 		AminoAcid{0.1975473066391, 'g'},
 		AminoAcid{0.3015094502008, 't'},
-	};
+	}
 
-	AccumulateProbabilities(iub);
-	AccumulateProbabilities(homosapiens);
+	AccumulateProbabilities(iub)
+	AccumulateProbabilities(homosapiens)
 
 	alu := strings.Bytes(
 		"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
@@ -168,12 +168,12 @@ func main() {
 			"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
 			"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
 			"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
-			"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA");
+			"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")
 
-	out.WriteString(">ONE Homo sapiens alu\n");
-	RepeatFasta(alu, 2**n);
-	out.WriteString(">TWO IUB ambiguity codes\n");
-	RandomFasta(iub, 3**n);
-	out.WriteString(">THREE Homo sapiens frequency\n");
-	RandomFasta(homosapiens, 5**n);
+	out.WriteString(">ONE Homo sapiens alu\n")
+	RepeatFasta(alu, 2**n)
+	out.WriteString(">TWO IUB ambiguity codes\n")
+	RandomFasta(iub, 3**n)
+	out.WriteString(">THREE Homo sapiens frequency\n")
+	RandomFasta(homosapiens, 5**n)
 }