Stowage/go
2
0
Fork 0
mirror of https://github.com/golang/go.git synced 2025-12-08 06:10:04 +00:00
Code Issues Projects Releases Packages Wiki Activity

1) Change default gofmt default settings for

Browse source 
parsing and printing to new syntax.

   Use -oldparser to parse the old syntax,
   use -oldprinter to print the old syntax.

2) Change default gofmt formatting settings
   to use tabs for indentation only and to use
   spaces for alignment. This will make the code
   alignment insensitive to an editor's tabwidth.

   Use -spaces=false to use tabs for alignment.

3) Manually changed src/exp/parser/parser_test.go
   so that it doesn't try to parse the parser's
   source files using the old syntax (they have
   new syntax now).

4) gofmt -w src misc test/bench

5th and last set of files.

R=rsc
CC=golang-dev
https://golang.org/cl/180050
This commit is contained in:
Robert Griesemer 2009-12-15 15:41:46 -08:00
parent d65a5cce89
commit 45ca9f7a9e
59 changed files with 5907 additions and 5907 deletions
Download patch file Download diff file Expand all files Collapse all files

82
src/pkg/syslog/syslog.go
View file

@ -9,10 +9,10 @@
package syslog
import (
"fmt";
"log";
"net";
"os";
"fmt"
"log"
"net"
"os"
)
type Priority int
@ -20,21 +20,21 @@ type Priority int
const (
// From /usr/include/sys/syslog.h.
// These are the same on Linux, BSD, and OS X.
LOG_EMERG Priority = iota;
LOG_ALERT;
LOG_CRIT;
LOG_ERR;
LOG_WARNING;
LOG_NOTICE;
LOG_INFO;
LOG_DEBUG;
LOG_EMERG Priority = iota
LOG_ALERT
LOG_CRIT
LOG_ERR
LOG_WARNING
LOG_NOTICE
LOG_INFO
LOG_DEBUG
)
// A Writer is a connection to a syslog server.
type Writer struct {
priority Priority;
prefix string;
conn net.Conn;
priority Priority
prefix string
conn net.Conn
}
// New establishes a new connection to the system log daemon.
@ -52,23 +52,23 @@ func Dial(network, raddr string, priority Priority, prefix string) (w *Writer, e
if prefix == "" {
prefix = os.Args[0]
}
var conn net.Conn;
var conn net.Conn
if network == "" {
conn, err = unixSyslog()
} else {
conn, err = net.Dial(network, "", raddr)
}
return &Writer{priority, prefix, conn}, err;
return &Writer{priority, prefix, conn}, err
}
func unixSyslog() (conn net.Conn, err os.Error) {
logTypes := []string{"unixgram", "unix"};
logPaths := []string{"/dev/log", "/var/run/syslog"};
var raddr string;
logTypes := []string{"unixgram", "unix"}
logPaths := []string{"/dev/log", "/var/run/syslog"}
var raddr string
for _, network := range logTypes {
for _, path := range logPaths {
raddr = path;
conn, err := net.Dial(network, "", raddr);
raddr = path
conn, err := net.Dial(network, "", raddr)
if err != nil {
continue
} else {
@ -76,7 +76,7 @@ func unixSyslog() (conn net.Conn, err os.Error) {
}
}
}
return nil, os.ErrorString("Unix syslog delivery error");
return nil, os.ErrorString("Unix syslog delivery error")
}
// Write sends a log message to the syslog daemon.
@ -84,51 +84,51 @@ func (w *Writer) Write(b []byte) (int, os.Error) {
if w.priority > LOG_DEBUG || w.priority < LOG_EMERG {
return 0, os.EINVAL
}
return fmt.Fprintf(w.conn, "<%d>%s: %s\n", w.priority, w.prefix, b);
return fmt.Fprintf(w.conn, "<%d>%s: %s\n", w.priority, w.prefix, b)
}
func (w *Writer) writeString(p Priority, s string) (int, os.Error) {
return fmt.Fprintf(w.conn, "<%d>%s: %s\n", p, w.prefix, s)
}
func (w *Writer) Close() os.Error { return w.conn.Close() }
func (w *Writer) Close() os.Error { return w.conn.Close() }
// Emerg logs a message using the LOG_EMERG priority.
func (w *Writer) Emerg(m string) (err os.Error) {
_, err = w.writeString(LOG_EMERG, m);
return err;
_, err = w.writeString(LOG_EMERG, m)
return err
}
// Crit logs a message using the LOG_CRIT priority.
func (w *Writer) Crit(m string) (err os.Error) {
_, err = w.writeString(LOG_CRIT, m);
return err;
_, err = w.writeString(LOG_CRIT, m)
return err
}
// ERR logs a message using the LOG_ERR priority.
func (w *Writer) Err(m string) (err os.Error) {
_, err = w.writeString(LOG_ERR, m);
return err;
_, err = w.writeString(LOG_ERR, m)
return err
}
// Warning logs a message using the LOG_WARNING priority.
func (w *Writer) Warning(m string) (err os.Error) {
_, err = w.writeString(LOG_WARNING, m);
return err;
_, err = w.writeString(LOG_WARNING, m)
return err
}
// Notice logs a message using the LOG_NOTICE priority.
func (w *Writer) Notice(m string) (err os.Error) {
_, err = w.writeString(LOG_NOTICE, m);
return err;
_, err = w.writeString(LOG_NOTICE, m)
return err
}
// Info logs a message using the LOG_INFO priority.
func (w *Writer) Info(m string) (err os.Error) {
_, err = w.writeString(LOG_INFO, m);
return err;
_, err = w.writeString(LOG_INFO, m)
return err
}
// Debug logs a message using the LOG_DEBUG priority.
func (w *Writer) Debug(m string) (err os.Error) {
_, err = w.writeString(LOG_DEBUG, m);
return err;
_, err = w.writeString(LOG_DEBUG, m)
return err
}
// NewLogger provides an object that implements the full log.Logger interface,
@ -136,9 +136,9 @@ func (w *Writer) Debug(m string) (err os.Error) {
// priority will be used for all messages sent using this interface.
// All messages are logged with priority p.
func NewLogger(p Priority, flag int) *log.Logger {
s, err := New(p, "");
s, err := New(p, "")
if err != nil {
return nil
}
return log.New(s, nil, "", flag);
return log.New(s, nil, "", flag)
}

64
src/pkg/syslog/syslog_test.go
View file

@ -4,91 +4,91 @@
package syslog
import (
"io";
"log";
"net";
"testing";
"io"
"log"
"net"
"testing"
)
var serverAddr string
func runSyslog(c net.PacketConn, done chan<- string) {
var buf [4096]byte;
var rcvd string = "";
var buf [4096]byte
var rcvd string = ""
for {
n, _, err := c.ReadFrom(&buf);
n, _, err := c.ReadFrom(&buf)
if err != nil || n == 0 {
break
}
rcvd += string(buf[0:n]);
rcvd += string(buf[0:n])
}
done <- rcvd;
done <- rcvd
}
func startServer(done chan<- string) {
c, e := net.ListenPacket("udp", ":0");
c, e := net.ListenPacket("udp", ":0")
if e != nil {
log.Exitf("net.ListenPacket failed udp :0 %v", e)
}
serverAddr = c.LocalAddr().String();
c.SetReadTimeout(10e6); // 10ms
go runSyslog(c, done);
serverAddr = c.LocalAddr().String()
c.SetReadTimeout(10e6) // 10ms
go runSyslog(c, done)
}
func TestNew(t *testing.T) {
s, err := New(LOG_INFO, "");
s, err := New(LOG_INFO, "")
if err != nil {
t.Fatalf("New() failed: %s", err)
}
// Don't send any messages.
s.Close();
s.Close()
}
func TestNewLogger(t *testing.T) {
f := NewLogger(LOG_INFO, 0);
f := NewLogger(LOG_INFO, 0)
if f == nil {
t.Errorf("NewLogger() failed\n")
}
}
func TestDial(t *testing.T) {
l, err := Dial("", "", LOG_ERR, "syslog_test");
l, err := Dial("", "", LOG_ERR, "syslog_test")
if err != nil {
t.Fatalf("Dial() failed: %s", err)
}
l.Close();
l.Close()
}
func TestUDPDial(t *testing.T) {
done := make(chan string);
startServer(done);
l, err := Dial("udp", serverAddr, LOG_INFO, "syslog_test");
done := make(chan string)
startServer(done)
l, err := Dial("udp", serverAddr, LOG_INFO, "syslog_test")
if err != nil {
t.Fatalf("syslog.Dial() failed: %s", err)
}
msg := "udp test";
l.Info(msg);
expected := "<6>syslog_test: udp test\n";
rcvd := <-done;
msg := "udp test"
l.Info(msg)
expected := "<6>syslog_test: udp test\n"
rcvd := <-done
if rcvd != expected {
t.Fatalf("s.Info() = '%q', but wanted '%q'", rcvd, expected)
}
}
func TestWrite(t *testing.T) {
done := make(chan string);
startServer(done);
l, err := Dial("udp", serverAddr, LOG_ERR, "syslog_test");
done := make(chan string)
startServer(done)
l, err := Dial("udp", serverAddr, LOG_ERR, "syslog_test")
if err != nil {
t.Fatalf("syslog.Dial() failed: %s", err)
}
msg := "write test";
_, err = io.WriteString(l, msg);
msg := "write test"
_, err = io.WriteString(l, msg)
if err != nil {
t.Fatalf("WriteString() failed: %s", err)
}
expected := "<3>syslog_test: write test\n";
rcvd := <-done;
expected := "<3>syslog_test: write test\n"
rcvd := <-done
if rcvd != expected {
t.Fatalf("s.Info() = '%q', but wanted '%q'", rcvd, expected)
}

246
src/pkg/tabwriter/tabwriter.go
View file

@ -11,11 +11,11 @@
package tabwriter
import (
"bytes";
"container/vector";
"io";
"os";
"utf8";
"bytes"
"container/vector"
"io"
"os"
"utf8"
)
@ -28,9 +28,9 @@ import (
// ('\t') terminated cell.
//
type cell struct {
size int; // cell size in bytes
width int; // cell width in runes
htab bool; // true if the cell is terminated by an htab ('\t')
size int // cell size in bytes
width int // cell width in runes
htab bool // true if the cell is terminated by an htab ('\t')
}
@ -78,38 +78,38 @@ type cell struct {
//
type Writer struct {
// configuration
output io.Writer;
minwidth int;
tabwidth int;
padding int;
padbytes [8]byte;
flags uint;
output io.Writer
minwidth int
tabwidth int
padding int
padbytes [8]byte
flags uint
// current state
buf bytes.Buffer; // collected text excluding tabs or line breaks
pos int; // buffer position up to which cell.width of incomplete cell has been computed
cell cell; // current incomplete cell; cell.width is up to buf[pos] excluding ignored sections
endChar byte; // terminating char of escaped sequence (Escape for escapes, '>', ';' for HTML tags/entities, or 0)
lines vector.Vector; // list of lines; each line is a list of cells
widths vector.IntVector; // list of column widths in runes - re-used during formatting
buf bytes.Buffer // collected text excluding tabs or line breaks
pos int // buffer position up to which cell.width of incomplete cell has been computed
cell cell // current incomplete cell; cell.width is up to buf[pos] excluding ignored sections
endChar byte // terminating char of escaped sequence (Escape for escapes, '>', ';' for HTML tags/entities, or 0)
lines vector.Vector // list of lines; each line is a list of cells
widths vector.IntVector // list of column widths in runes - re-used during formatting
}
func (b *Writer) addLine() { b.lines.Push(new(vector.Vector)) }
func (b *Writer) addLine() { b.lines.Push(new(vector.Vector)) }
func (b *Writer) line(i int) *vector.Vector { return b.lines.At(i).(*vector.Vector) }
func (b *Writer) line(i int) *vector.Vector { return b.lines.At(i).(*vector.Vector) }
// Reset the current state.
func (b *Writer) reset() {
b.buf.Reset();
b.pos = 0;
b.cell = cell{};
b.endChar = 0;
b.lines.Resize(0, 0);
b.widths.Resize(0, 0);
b.addLine();
b.buf.Reset()
b.pos = 0
b.cell = cell{}
b.endChar = 0
b.lines.Resize(0, 0)
b.widths.Resize(0, 0)
b.addLine()
}
@ -141,23 +141,23 @@ func (b *Writer) reset() {
const (
// Ignore html tags and treat entities (starting with '&'
// and ending in ';') as single characters (width = 1).
FilterHTML uint = 1 << iota;
FilterHTML uint = 1 << iota
// Force right-alignment of cell content.
// Default is left-alignment.
AlignRight;
AlignRight
// Handle empty columns as if they were not present in
// the input in the first place.
DiscardEmptyColumns;
DiscardEmptyColumns
// Always use tabs for indentation columns (i.e., padding of
// leading empty cells on the left) independent of padchar.
TabIndent;
TabIndent
// Print a vertical bar ('|') between columns (after formatting).
// Discarded colums appear as zero-width columns ("||").
Debug;
Debug
)
@ -185,10 +185,10 @@ func (b *Writer) Init(output io.Writer, minwidth, tabwidth, padding int, padchar
if minwidth < 0 || tabwidth < 0 || padding < 0 {
panic("negative minwidth, tabwidth, or padding")
}
b.output = output;
b.minwidth = minwidth;
b.tabwidth = tabwidth;
b.padding = padding;
b.output = output
b.minwidth = minwidth
b.tabwidth = tabwidth
b.padding = padding
for i := range b.padbytes {
b.padbytes[i] = padchar
}
@ -196,37 +196,37 @@ func (b *Writer) Init(output io.Writer, minwidth, tabwidth, padding int, padchar
// tab padding enforces left-alignment
flags &^= AlignRight
}
b.flags = flags;
b.flags = flags
b.reset();
b.reset()
return b;
return b
}
// debugging support (keep code around)
func (b *Writer) dump() {
pos := 0;
pos := 0
for i := 0; i < b.lines.Len(); i++ {
line := b.line(i);
print("(", i, ") ");
line := b.line(i)
print("(", i, ") ")
for j := 0; j < line.Len(); j++ {
c := line.At(j).(cell);
print("[", string(b.buf.Bytes()[pos:pos+c.size]), "]");
pos += c.size;
c := line.At(j).(cell)
print("[", string(b.buf.Bytes()[pos:pos+c.size]), "]")
pos += c.size
}
print("\n");
print("\n")
}
print("\n");
print("\n")
}
func (b *Writer) write0(buf []byte) os.Error {
n, err := b.output.Write(buf);
n, err := b.output.Write(buf)
if n != len(buf) && err == nil {
err = os.EIO
}
return err;
return err
}
@ -235,15 +235,15 @@ func (b *Writer) writeN(src []byte, n int) os.Error {
if err := b.write0(src); err != nil {
return err
}
n -= len(src);
n -= len(src)
}
return b.write0(src[0:n]);
return b.write0(src[0:n])
}
var (
newline = []byte{'\n'};
tabs = []byte{'\t', '\t', '\t', '\t', '\t', '\t', '\t', '\t'};
newline = []byte{'\n'}
tabs = []byte{'\t', '\t', '\t', '\t', '\t', '\t', '\t', '\t'}
)
@ -251,34 +251,34 @@ func (b *Writer) writePadding(textw, cellw int, useTabs bool) os.Error {
if b.padbytes[0] == '\t' || useTabs {
// padding is done with tabs
if b.tabwidth == 0 {
return nil // tabs have no width - can't do any padding
return nil // tabs have no width - can't do any padding
}
// make cellw the smallest multiple of b.tabwidth
cellw = (cellw + b.tabwidth - 1) / b.tabwidth * b.tabwidth;
n := cellw - textw; // amount of padding
cellw = (cellw + b.tabwidth - 1) / b.tabwidth * b.tabwidth
n := cellw - textw // amount of padding
if n < 0 {
panic("internal error")
}
return b.writeN(tabs, (n+b.tabwidth-1)/b.tabwidth);
return b.writeN(tabs, (n+b.tabwidth-1)/b.tabwidth)
}
// padding is done with non-tab characters
return b.writeN(&b.padbytes, cellw-textw);
return b.writeN(&b.padbytes, cellw-textw)
}
var vbar = []byte{'|'}
func (b *Writer) writeLines(pos0 int, line0, line1 int) (pos int, err os.Error) {
pos = pos0;
pos = pos0
for i := line0; i < line1; i++ {
line := b.line(i);
line := b.line(i)
// if TabIndent is set, use tabs to pad leading empty cells
useTabs := b.flags&TabIndent != 0;
useTabs := b.flags&TabIndent != 0
for j := 0; j < line.Len(); j++ {
c := line.At(j).(cell);
c := line.At(j).(cell)
if j > 0 && b.flags&Debug != 0 {
if err = b.write0(vbar); err != nil {
@ -295,18 +295,18 @@ func (b *Writer) writeLines(pos0 int, line0, line1 int) (pos int, err os.Error)
}
} else {
// non-empty cell
useTabs = false;
if b.flags&AlignRight == 0 { // align left
useTabs = false
if b.flags&AlignRight == 0 { // align left
if err = b.write0(b.buf.Bytes()[pos : pos+c.size]); err != nil {
return
}
pos += c.size;
pos += c.size
if j < b.widths.Len() {
if err = b.writePadding(c.width, b.widths.At(j), false); err != nil {
return
}
}
} else { // align right
} else { // align right
if j < b.widths.Len() {
if err = b.writePadding(c.width, b.widths.At(j), false); err != nil {
return
@ -315,7 +315,7 @@ func (b *Writer) writeLines(pos0 int, line0, line1 int) (pos int, err os.Error)
if err = b.write0(b.buf.Bytes()[pos : pos+c.size]); err != nil {
return
}
pos += c.size;
pos += c.size
}
}
}
@ -326,7 +326,7 @@ func (b *Writer) writeLines(pos0 int, line0, line1 int) (pos int, err os.Error)
if err = b.write0(b.buf.Bytes()[pos : pos+b.cell.size]); err != nil {
return
}
pos += b.cell.size;
pos += b.cell.size
} else {
// not the last line - write newline
if err = b.write0(newline); err != nil {
@ -334,7 +334,7 @@ func (b *Writer) writeLines(pos0 int, line0, line1 int) (pos int, err os.Error)
}
}
}
return;
return
}
@ -344,10 +344,10 @@ func (b *Writer) writeLines(pos0 int, line0, line1 int) (pos int, err os.Error)
// line1 and an error, if any.
//
func (b *Writer) format(pos0 int, line0, line1 int) (pos int, err os.Error) {
pos = pos0;
column := b.widths.Len();
pos = pos0
column := b.widths.Len()
for this := line0; this < line1; this++ {
line := b.line(this);
line := b.line(this)
if column < line.Len()-1 {
// cell exists in this column => this line
@ -361,16 +361,16 @@ func (b *Writer) format(pos0 int, line0, line1 int) (pos int, err os.Error) {
if pos, err = b.writeLines(pos, line0, this); err != nil {
return
}
line0 = this;
line0 = this
// column block begin
width := b.minwidth; // minimal column width
discardable := true; // true if all cells in this column are empty and "soft"
width := b.minwidth // minimal column width
discardable := true // true if all cells in this column are empty and "soft"
for ; this < line1; this++ {
line = b.line(this);
line = b.line(this)
if column < line.Len()-1 {
// cell exists in this column
c := line.At(column).(cell);
c := line.At(column).(cell)
// update width
if w := c.width + b.padding; w > width {
width = w
@ -392,29 +392,29 @@ func (b *Writer) format(pos0 int, line0, line1 int) (pos int, err os.Error) {
// format and print all columns to the right of this column
// (we know the widths of this column and all columns to the left)
b.widths.Push(width);
pos, err = b.format(pos, line0, this);
b.widths.Pop();
line0 = this;
b.widths.Push(width)
pos, err = b.format(pos, line0, this)
b.widths.Pop()
line0 = this
}
}
// print unprinted lines until end
return b.writeLines(pos, line0, line1);
return b.writeLines(pos, line0, line1)
}
// Append text to current cell.
func (b *Writer) append(text []byte) {
b.buf.Write(text);
b.cell.size += len(text);
b.buf.Write(text)
b.cell.size += len(text)
}
// Update the cell width.
func (b *Writer) updateWidth() {
b.cell.width += utf8.RuneCount(b.buf.Bytes()[b.pos:b.buf.Len()]);
b.pos = b.buf.Len();
b.cell.width += utf8.RuneCount(b.buf.Bytes()[b.pos:b.buf.Len()])
b.pos = b.buf.Len()
}
@ -450,12 +450,12 @@ func (b *Writer) endEscape() {
switch b.endChar {
case Escape:
b.updateWidth()
case '>': // tag of zero width
case '>': // tag of zero width
case ';':
b.cell.width++ // entity, count as one rune
b.cell.width++ // entity, count as one rune
}
b.pos = b.buf.Len();
b.endChar = 0;
b.pos = b.buf.Len()
b.endChar = 0
}
@ -463,11 +463,11 @@ func (b *Writer) endEscape() {
// current line. Returns the number of cells in that line.
//
func (b *Writer) terminateCell(htab bool) int {
b.cell.htab = htab;
line := b.line(b.lines.Len() - 1);
line.Push(b.cell);
b.cell = cell{};
return line.Len();
b.cell.htab = htab
line := b.line(b.lines.Len() - 1)
line.Push(b.cell)
b.cell = cell{}
return line.Len()
}
@ -483,16 +483,16 @@ func (b *Writer) Flush() os.Error {
// inside escape - terminate it even if incomplete
b.endEscape()
}
b.terminateCell(false);
b.terminateCell(false)
}
// format contents of buffer
_, err := b.format(0, 0, b.lines.Len());
_, err := b.format(0, 0, b.lines.Len())
// reset, even in the presence of errors
b.reset();
b.reset()
return err;
return err
}
@ -502,20 +502,20 @@ func (b *Writer) Flush() os.Error {
//
func (b *Writer) Write(buf []byte) (n int, err os.Error) {
// split text into cells
n = 0;
n = 0
for i, ch := range buf {
if b.endChar == 0 {
// outside escape
switch ch {
case '\t', '\v', '\n', '\f':
// end of cell
b.append(buf[n:i]);
b.updateWidth();
n = i + 1; // ch consumed
ncells := b.terminateCell(ch == '\t');
b.append(buf[n:i])
b.updateWidth()
n = i + 1 // ch consumed
ncells := b.terminateCell(ch == '\t')
if ch == '\n' || ch == '\f' {
// terminate line
b.addLine();
b.addLine()
if ch == '\f' || ncells == 1 {
// A '\f' always forces a flush. Otherwise, if the previous
// line has only one cell which does not have an impact on
@ -530,19 +530,19 @@ func (b *Writer) Write(buf []byte) (n int, err os.Error) {
case Escape:
// start of escaped sequence
b.append(buf[n:i]);
b.updateWidth();
n = i + 1; // exclude Escape
b.startEscape(Escape);
b.append(buf[n:i])
b.updateWidth()
n = i + 1 // exclude Escape
b.startEscape(Escape)
case '<', '&':
// possibly an html tag/entity
if b.flags&FilterHTML != 0 {
// begin of tag/entity
b.append(buf[n:i]);
b.updateWidth();
n = i;
b.startEscape(ch);
b.append(buf[n:i])
b.updateWidth()
n = i
b.startEscape(ch)
}
}
@ -550,21 +550,21 @@ func (b *Writer) Write(buf []byte) (n int, err os.Error) {
// inside escape
if ch == b.endChar {
// end of tag/entity
j := i + 1;
j := i + 1
if ch == Escape {
j = i // exclude Escape
j = i // exclude Escape
}
b.append(buf[n:j]);
n = i + 1; // ch consumed
b.endEscape();
b.append(buf[n:j])
n = i + 1 // ch consumed
b.endEscape()
}
}
}
// append leftover text
b.append(buf[n:]);
n = len(buf);
return;
b.append(buf[n:])
n = len(buf)
return
}

82
src/pkg/tabwriter/tabwriter_test.go
View file

@ -5,43 +5,43 @@
package tabwriter
import (
"io";
"os";
"testing";
"io"
"os"
"testing"
)
type buffer struct {
a []byte;
a []byte
}
func (b *buffer) init(n int) { b.a = make([]byte, n)[0:0] }
func (b *buffer) init(n int) { b.a = make([]byte, n)[0:0] }
func (b *buffer) clear() { b.a = b.a[0:0] }
func (b *buffer) clear() { b.a = b.a[0:0] }
func (b *buffer) Write(buf []byte) (written int, err os.Error) {
n := len(b.a);
m := len(buf);
n := len(b.a)
m := len(buf)
if n+m <= cap(b.a) {
b.a = b.a[0 : n+m];
b.a = b.a[0 : n+m]
for i := 0; i < m; i++ {
b.a[n+i] = buf[i]
}
} else {
panicln("buffer.Write: buffer too small", n, m, cap(b.a))
}
return len(buf), nil;
return len(buf), nil
}
func (b *buffer) String() string { return string(b.a) }
func (b *buffer) String() string { return string(b.a) }
func write(t *testing.T, testname string, w *Writer, src string) {
written, err := io.WriteString(w, src);
written, err := io.WriteString(w, src)
if err != nil {
t.Errorf("--- test: %s\n--- src:\n%s\n--- write error: %v\n", testname, src, err)
}
@ -52,12 +52,12 @@ func write(t *testing.T, testname string, w *Writer, src string) {
func verify(t *testing.T, testname string, w *Writer, b *buffer, src, expected string) {
err := w.Flush();
err := w.Flush()
if err != nil {
t.Errorf("--- test: %s\n--- src:\n%s\n--- flush error: %v\n", testname, src, err)
}
res := b.String();
res := b.String()
if res != expected {
t.Errorf("--- test: %s\n--- src:\n%s\n--- found:\n%s\n--- expected:\n%s\n", testname, src, res, expected)
}
@ -65,43 +65,43 @@ func verify(t *testing.T, testname string, w *Writer, b *buffer, src, expected s
func check(t *testing.T, testname string, minwidth, tabwidth, padding int, padchar byte, flags uint, src, expected string) {
var b buffer;
b.init(1000);
var b buffer
b.init(1000)
var w Writer;
w.Init(&b, minwidth, tabwidth, padding, padchar, flags);
var w Writer
w.Init(&b, minwidth, tabwidth, padding, padchar, flags)
// write all at once
b.clear();
write(t, testname, &w, src);
verify(t, testname, &w, &b, src, expected);
b.clear()
write(t, testname, &w, src)
verify(t, testname, &w, &b, src, expected)
// write byte-by-byte
b.clear();
b.clear()
for i := 0; i < len(src); i++ {
write(t, testname, &w, src[i:i+1])
}
verify(t, testname, &w, &b, src, expected);
verify(t, testname, &w, &b, src, expected)
// write using Fibonacci slice sizes
b.clear();
b.clear()
for i, d := 0, 0; i < len(src); {
write(t, testname, &w, src[i:i+d]);
i, d = i+d, d+1;
write(t, testname, &w, src[i:i+d])
i, d = i+d, d+1
if i+d > len(src) {
d = len(src) - i
}
}
verify(t, testname, &w, &b, src, expected);
verify(t, testname, &w, &b, src, expected)
}
type entry struct {
testname string;
minwidth, tabwidth, padding int;
padchar byte;
flags uint;
src, expected string;
testname string
minwidth, tabwidth, padding int
padchar byte
flags uint
src, expected string
}
@ -144,7 +144,7 @@ var tests = []entry{
entry{
"1e esc",
8, 0, 1, '.', 0,
"abc\xff\tdef", // unterminated escape
"abc\xff\tdef", // unterminated escape
"abc\tdef",
},
@ -165,14 +165,14 @@ var tests = []entry{
entry{
"4a",
8, 0, 1, '.', 0,
"\t", // '\t' terminates an empty cell on last line - nothing to print
"\t", // '\t' terminates an empty cell on last line - nothing to print
"",
},
entry{
"4b",
8, 0, 1, '.', AlignRight,
"\t", // '\t' terminates an empty cell on last line - nothing to print
"\t", // '\t' terminates an empty cell on last line - nothing to print
"",
},
@ -294,7 +294,7 @@ var tests = []entry{
entry{
"9b",
1, 0, 0, '.', FilterHTML,
"1\t2<!---\f--->\t3\t4\n" + // \f inside HTML is ignored
"1\t2<!---\f--->\t3\t4\n" + // \f inside HTML is ignored
"11\t222\t3333\t44444\n",
"1.2<!---\f--->..3...4\n" +
@ -304,7 +304,7 @@ var tests = []entry{
entry{
"9c",
1, 0, 0, '.', 0,
"1\t2\t3\t4\f" + // \f causes a newline and flush
"1\t2\t3\t4\f" + // \f causes a newline and flush
"11\t222\t3333\t44444\n",
"1234\n" +
@ -314,7 +314,7 @@ var tests = []entry{
entry{
"9c debug",
1, 0, 0, '.', Debug,
"1\t2\t3\t4\f" + // \f causes a newline and flush
"1\t2\t3\t4\f" + // \f causes a newline and flush
"11\t222\t3333\t44444\n",
"1|2|3|4\n" +
@ -489,7 +489,7 @@ var tests = []entry{
entry{
"15b",
4, 0, 0, '.', DiscardEmptyColumns,
"a\t\tb", // htabs - do not discard column
"a\t\tb", // htabs - do not discard column
"a.......b",
},
@ -558,7 +558,7 @@ var tests = []entry{
entry{
"16c",
100, 100, 0, '\t', DiscardEmptyColumns,
"a\tb\t\td\n" + // hard tabs - do not discard column
"a\tb\t\td\n" + // hard tabs - do not discard column
"a\tb\t\td\te\n" +
"a\n" +
"a\tb\tc\td\n" +
@ -574,7 +574,7 @@ var tests = []entry{
entry{
"16c debug",
100, 100, 0, '\t', DiscardEmptyColumns | Debug,
"a\tb\t\td\n" + // hard tabs - do not discard column
"a\tb\t\td\n" + // hard tabs - do not discard column
"a\tb\t\td\te\n" +
"a\n" +
"a\tb\tc\td\n" +

42
src/pkg/template/format.go
View file

@ -7,10 +7,10 @@
package template
import (
"bytes";
"fmt";
"io";
"strings";
"bytes"
"fmt"
"io"
"strings"
)
// StringFormatter formats into the default string representation.
@ -19,25 +19,25 @@ import (
// under the name "" in your custom formatter map.
func StringFormatter(w io.Writer, value interface{}, format string) {
if b, ok := value.([]byte); ok {
w.Write(b);
return;
w.Write(b)
return
}
fmt.Fprint(w, value);
fmt.Fprint(w, value)
}
var (
esc_quot = strings.Bytes("&#34;"); // shorter than "&quot;"
esc_apos = strings.Bytes("&#39;"); // shorter than "&apos;"
esc_amp = strings.Bytes("&amp;");
esc_lt = strings.Bytes("&lt;");
esc_gt = strings.Bytes("&gt;");
esc_quot = strings.Bytes("&#34;") // shorter than "&quot;"
esc_apos = strings.Bytes("&#39;") // shorter than "&apos;"
esc_amp = strings.Bytes("&amp;")
esc_lt = strings.Bytes("&lt;")
esc_gt = strings.Bytes("&gt;")
)
// HTMLEscape writes to w the properly escaped HTML equivalent
// of the plain text data s.
func HTMLEscape(w io.Writer, s []byte) {
var esc []byte;
last := 0;
var esc []byte
last := 0
for i, c := range s {
switch c {
case '"':
@ -53,16 +53,16 @@ func HTMLEscape(w io.Writer, s []byte) {
default:
continue
}
w.Write(s[last:i]);
w.Write(esc);
last = i + 1;
w.Write(s[last:i])
w.Write(esc)
last = i + 1
}
w.Write(s[last:]);
w.Write(s[last:])
}
// HTMLFormatter formats arbitrary values for HTML
func HTMLFormatter(w io.Writer, value interface{}, format string) {
var b bytes.Buffer;
fmt.Fprint(&b, value);
HTMLEscape(w, b.Bytes());
var b bytes.Buffer
fmt.Fprint(&b, value)
HTMLEscape(w, b.Bytes())
}

520
src/pkg/template/template.go
View file

@ -57,23 +57,23 @@
package template
import (
"container/vector";
"fmt";
"io";
"os";
"reflect";
"runtime";
"strings";
"container/vector"
"fmt"
"io"
"os"
"reflect"
"runtime"
"strings"
)
// Errors returned during parsing and execution. Users may extract the information and reformat
// if they desire.
type Error struct {
Line int;
Msg string;
Line int
Msg string
}
func (e *Error) String() string { return fmt.Sprintf("line %d: %s", e.Line, e.Msg) }
func (e *Error) String() string { return fmt.Sprintf("line %d: %s", e.Line, e.Msg) }
// Most of the literals are aces.
var lbrace = []byte{'{'}
@ -83,15 +83,15 @@ var tab = []byte{'\t'}
// The various types of "tokens", which are plain text or (usually) brace-delimited descriptors
const (
tokAlternates = iota;
tokComment;
tokEnd;
tokLiteral;
tokOr;
tokRepeated;
tokSection;
tokText;
tokVariable;
tokAlternates = iota
tokComment
tokEnd
tokLiteral
tokOr
tokRepeated
tokSection
tokText
tokVariable
)
// FormatterMap is the type describing the mapping from formatter
@ -110,59 +110,59 @@ var builtins = FormatterMap{
// Plain text.
type textElement struct {
text []byte;
text []byte
}
// A literal such as .meta-left or .meta-right
type literalElement struct {
text []byte;
text []byte
}
// A variable to be evaluated
type variableElement struct {
linenum int;
name string;
formatter string; // TODO(r): implement pipelines
linenum int
name string
formatter string // TODO(r): implement pipelines
}
// A .section block, possibly with a .or
type sectionElement struct {
linenum int; // of .section itself
field string; // cursor field for this block
start int; // first element
or int; // first element of .or block
end int; // one beyond last element
linenum int // of .section itself
field string // cursor field for this block
start int // first element
or int // first element of .or block
end int // one beyond last element
}
// A .repeated block, possibly with a .or and a .alternates
type repeatedElement struct {
sectionElement; // It has the same structure...
altstart int; // ... except for alternates
altend int;
sectionElement // It has the same structure...
altstart int // ... except for alternates
altend int
}
// Template is the type that represents a template definition.
// It is unchanged after parsing.
type Template struct {
fmap FormatterMap; // formatters for variables
fmap FormatterMap // formatters for variables
// Used during parsing:
ldelim, rdelim []byte; // delimiters; default {}
buf []byte; // input text to process
p int; // position in buf
linenum int; // position in input
error os.Error; // error during parsing (only)
ldelim, rdelim []byte // delimiters; default {}
buf []byte // input text to process
p int // position in buf
linenum int // position in input
error os.Error // error during parsing (only)
// Parsed results:
elems *vector.Vector;
elems *vector.Vector
}
// Internal state for executing a Template. As we evaluate the struct,
// the data item descends into the fields associated with sections, etc.
// Parent is used to walk upwards to find variables higher in the tree.
type state struct {
parent *state; // parent in hierarchy
data reflect.Value; // the driver data for this section etc.
wr io.Writer; // where to send output
errors chan os.Error; // for reporting errors during execute
parent *state // parent in hierarchy
data reflect.Value // the driver data for this section etc.
wr io.Writer // where to send output
errors chan os.Error // for reporting errors during execute
}
func (parent *state) clone(data reflect.Value) *state {
@ -172,18 +172,18 @@ func (parent *state) clone(data reflect.Value) *state {
// New creates a new template with the specified formatter map (which
// may be nil) to define auxiliary functions for formatting variables.
func New(fmap FormatterMap) *Template {
t := new(Template);
t.fmap = fmap;
t.ldelim = lbrace;
t.rdelim = rbrace;
t.elems = new(vector.Vector);
return t;
t := new(Template)
t.fmap = fmap
t.ldelim = lbrace
t.rdelim = rbrace
t.elems = new(vector.Vector)
return t
}
// Report error and stop executing. The line number must be provided explicitly.
func (t *Template) execError(st *state, line int, err string, args ...) {
st.errors <- &Error{line, fmt.Sprintf(err, args)};
runtime.Goexit();
st.errors <- &Error{line, fmt.Sprintf(err, args)}
runtime.Goexit()
}
// Report error, save in Template to terminate parsing.
@ -195,12 +195,12 @@ func (t *Template) parseError(err string, args ...) {
// -- Lexical analysis
// Is c a white space character?
func white(c uint8) bool { return c == ' ' || c == '\t' || c == '\r' || c == '\n' }
func white(c uint8) bool { return c == ' ' || c == '\t' || c == '\r' || c == '\n' }
// Safely, does s[n:n+len(t)] == t?
func equal(s []byte, n int, t []byte) bool {
b := s[n:];
if len(t) > len(b) { // not enough space left for a match.
b := s[n:]
if len(t) > len(b) { // not enough space left for a match.
return false
}
for i, c := range t {
@ -208,7 +208,7 @@ func equal(s []byte, n int, t []byte) bool {
return false
}
}
return true;
return true
}
// nextItem returns the next item from the input buffer. If the returned
@ -218,179 +218,179 @@ func equal(s []byte, n int, t []byte) bool {
// Action tokens on a line by themselves drop the white space on
// either side, up to and including the newline.
func (t *Template) nextItem() []byte {
sawLeft := false; // are we waiting for an opening delimiter?
special := false; // is this a {.foo} directive, which means trim white space?
sawLeft := false // are we waiting for an opening delimiter?
special := false // is this a {.foo} directive, which means trim white space?
// Delete surrounding white space if this {.foo} is the only thing on the line.
trim_white := t.p == 0 || t.buf[t.p-1] == '\n';
only_white := true; // we have seen only white space so far
var i int;
start := t.p;
trim_white := t.p == 0 || t.buf[t.p-1] == '\n'
only_white := true // we have seen only white space so far
var i int
start := t.p
Loop:
for i = t.p; i < len(t.buf); i++ {
switch {
case t.buf[i] == '\n':
t.linenum++;
i++;
break Loop;
t.linenum++
i++
break Loop
case white(t.buf[i]):
// white space, do nothing
case !sawLeft && equal(t.buf, i, t.ldelim): // sawLeft checked because delims may be equal
case !sawLeft && equal(t.buf, i, t.ldelim): // sawLeft checked because delims may be equal
// anything interesting already on the line?
if !only_white {
break Loop
}
// is it a directive or comment?
j := i + len(t.ldelim); // position after delimiter
j := i + len(t.ldelim) // position after delimiter
if j+1 < len(t.buf) && (t.buf[j] == '.' || t.buf[j] == '#') {
special = true;
special = true
if trim_white && only_white {
start = i
}
} else if i > t.p { // have some text accumulated so stop before delimiter
} else if i > t.p { // have some text accumulated so stop before delimiter
break Loop
}
sawLeft = true;
i = j - 1;
sawLeft = true
i = j - 1
case equal(t.buf, i, t.rdelim):
if !sawLeft {
t.parseError("unmatched closing delimiter");
return nil;
t.parseError("unmatched closing delimiter")
return nil
}
sawLeft = false;
i += len(t.rdelim);
break Loop;
sawLeft = false
i += len(t.rdelim)
break Loop
default:
only_white = false
}
}
if sawLeft {
t.parseError("unmatched opening delimiter");
return nil;
t.parseError("unmatched opening delimiter")
return nil
}
item := t.buf[start:i];
item := t.buf[start:i]
if special && trim_white {
// consume trailing white space
for ; i < len(t.buf) && white(t.buf[i]); i++ {
if t.buf[i] == '\n' {
t.linenum++;
i++;
break; // stop after newline
t.linenum++
i++
break // stop after newline
}
}
}
t.p = i;
return item;
t.p = i
return item
}
// Turn a byte array into a white-space-split array of strings.
func words(buf []byte) []string {
s := make([]string, 0, 5);
p := 0; // position in buf
s := make([]string, 0, 5)
p := 0 // position in buf
// one word per loop
for i := 0; ; i++ {
// skip white space
for ; p < len(buf) && white(buf[p]); p++ {
}
// grab word
start := p;
start := p
for ; p < len(buf) && !white(buf[p]); p++ {
}
if start == p { // no text left
if start == p { // no text left
break
}
if i == cap(s) {
ns := make([]string, 2*cap(s));
ns := make([]string, 2*cap(s))
for j := range s {
ns[j] = s[j]
}
s = ns;
s = ns
}
s = s[0 : i+1];
s[i] = string(buf[start:p]);
s = s[0 : i+1]
s[i] = string(buf[start:p])
}
return s;
return s
}
// Analyze an item and return its token type and, if it's an action item, an array of
// its constituent words.
func (t *Template) analyze(item []byte) (tok int, w []string) {
// item is known to be non-empty
if !equal(item, 0, t.ldelim) { // doesn't start with left delimiter
tok = tokText;
return;
if !equal(item, 0, t.ldelim) { // doesn't start with left delimiter
tok = tokText
return
}
if !equal(item, len(item)-len(t.rdelim), t.rdelim) { // doesn't end with right delimiter
t.parseError("internal error: unmatched opening delimiter"); // lexing should prevent this
return;
if !equal(item, len(item)-len(t.rdelim), t.rdelim) { // doesn't end with right delimiter
t.parseError("internal error: unmatched opening delimiter") // lexing should prevent this
return
}
if len(item) <= len(t.ldelim)+len(t.rdelim) { // no contents
t.parseError("empty directive");
return;
if len(item) <= len(t.ldelim)+len(t.rdelim) { // no contents
t.parseError("empty directive")
return
}
// Comment
if item[len(t.ldelim)] == '#' {
tok = tokComment;
return;
tok = tokComment
return
}
// Split into words
w = words(item[len(t.ldelim) : len(item)-len(t.rdelim)]); // drop final delimiter
w = words(item[len(t.ldelim) : len(item)-len(t.rdelim)]) // drop final delimiter
if len(w) == 0 {
t.parseError("empty directive");
return;
t.parseError("empty directive")
return
}
if len(w) == 1 && w[0][0] != '.' {
tok = tokVariable;
return;
tok = tokVariable
return
}
switch w[0] {
case ".meta-left", ".meta-right", ".space", ".tab":
tok = tokLiteral;
return;
tok = tokLiteral
return
case ".or":
tok = tokOr;
return;
tok = tokOr
return
case ".end":
tok = tokEnd;
return;
tok = tokEnd
return
case ".section":
if len(w) != 2 {
t.parseError("incorrect fields for .section: %s", item);
return;
t.parseError("incorrect fields for .section: %s", item)
return
}
tok = tokSection;
return;
tok = tokSection
return
case ".repeated":
if len(w) != 3 || w[1] != "section" {
t.parseError("incorrect fields for .repeated: %s", item);
return;
t.parseError("incorrect fields for .repeated: %s", item)
return
}
tok = tokRepeated;
return;
tok = tokRepeated
return
case ".alternates":
if len(w) != 2 || w[1] != "with" {
t.parseError("incorrect fields for .alternates: %s", item);
return;
t.parseError("incorrect fields for .alternates: %s", item)
return
}
tok = tokAlternates;
return;
tok = tokAlternates
return
}
t.parseError("bad directive: %s", item);
return;
t.parseError("bad directive: %s", item)
return
}
// -- Parsing
// Allocate a new variable-evaluation element.
func (t *Template) newVariable(name_formatter string) (v *variableElement) {
name := name_formatter;
formatter := "";
bar := strings.Index(name_formatter, "|");
name := name_formatter
formatter := ""
bar := strings.Index(name_formatter, "|")
if bar >= 0 {
name = name_formatter[0:bar];
formatter = name_formatter[bar+1:];
name = name_formatter[0:bar]
formatter = name_formatter[bar+1:]
}
// Probably ok, so let's build it.
v = &variableElement{t.linenum, name, formatter};
v = &variableElement{t.linenum, name, formatter}
// We could remember the function address here and avoid the lookup later,
// but it's more dynamic to let the user change the map contents underfoot.
@ -406,24 +406,24 @@ func (t *Template) newVariable(name_formatter string) (v *variableElement) {
if _, ok := builtins[formatter]; ok {
return
}
t.parseError("unknown formatter: %s", formatter);
return;
t.parseError("unknown formatter: %s", formatter)
return
}
// Grab the next item. If it's simple, just append it to the template.
// Otherwise return its details.
func (t *Template) parseSimple(item []byte) (done bool, tok int, w []string) {
tok, w = t.analyze(item);
tok, w = t.analyze(item)
if t.error != nil {
return
}
done = true; // assume for simplicity
done = true // assume for simplicity
switch tok {
case tokComment:
return
case tokText:
t.elems.Push(&textElement{item});
return;
t.elems.Push(&textElement{item})
return
case tokLiteral:
switch w[0] {
case ".meta-left":
@ -435,40 +435,40 @@ func (t *Template) parseSimple(item []byte) (done bool, tok int, w []string) {
case ".tab":
t.elems.Push(&literalElement{tab})
default:
t.parseError("internal error: unknown literal: %s", w[0]);
return;
t.parseError("internal error: unknown literal: %s", w[0])
return
}
return;
return
case tokVariable:
t.elems.Push(t.newVariable(w[0]));
return;
t.elems.Push(t.newVariable(w[0]))
return
}
return false, tok, w;
return false, tok, w
}
// parseRepeated and parseSection are mutually recursive
func (t *Template) parseRepeated(words []string) *repeatedElement {
r := new(repeatedElement);
t.elems.Push(r);
r.linenum = t.linenum;
r.field = words[2];
r := new(repeatedElement)
t.elems.Push(r)
r.linenum = t.linenum
r.field = words[2]
// Scan section, collecting true and false (.or) blocks.
r.start = t.elems.Len();
r.or = -1;
r.altstart = -1;
r.altend = -1;
r.start = t.elems.Len()
r.or = -1
r.altstart = -1
r.altend = -1
Loop:
for t.error == nil {
item := t.nextItem();
item := t.nextItem()
if t.error != nil {
break
}
if len(item) == 0 {
t.parseError("missing .end for .repeated section");
break;
t.parseError("missing .end for .repeated section")
break
}
done, tok, w := t.parseSimple(item);
done, tok, w := t.parseSimple(item)
if t.error != nil {
break
}
@ -480,28 +480,28 @@ Loop:
break Loop
case tokOr:
if r.or >= 0 {
t.parseError("extra .or in .repeated section");
break Loop;
t.parseError("extra .or in .repeated section")
break Loop
}
r.altend = t.elems.Len();
r.or = t.elems.Len();
r.altend = t.elems.Len()
r.or = t.elems.Len()
case tokSection:
t.parseSection(w)
case tokRepeated:
t.parseRepeated(w)
case tokAlternates:
if r.altstart >= 0 {
t.parseError("extra .alternates in .repeated section");
break Loop;
t.parseError("extra .alternates in .repeated section")
break Loop
}
if r.or >= 0 {
t.parseError(".alternates inside .or block in .repeated section");
break Loop;
t.parseError(".alternates inside .or block in .repeated section")
break Loop
}
r.altstart = t.elems.Len();
r.altstart = t.elems.Len()
default:
t.parseError("internal error: unknown repeated section item: %s", item);
break Loop;
t.parseError("internal error: unknown repeated section item: %s", item)
break Loop
}
}
if t.error != nil {
@ -510,29 +510,29 @@ Loop:
if r.altend < 0 {
r.altend = t.elems.Len()
}
r.end = t.elems.Len();
return r;
r.end = t.elems.Len()
return r
}
func (t *Template) parseSection(words []string) *sectionElement {
s := new(sectionElement);
t.elems.Push(s);
s.linenum = t.linenum;
s.field = words[1];
s := new(sectionElement)
t.elems.Push(s)
s.linenum = t.linenum
s.field = words[1]
// Scan section, collecting true and false (.or) blocks.
s.start = t.elems.Len();
s.or = -1;
s.start = t.elems.Len()
s.or = -1
Loop:
for t.error == nil {
item := t.nextItem();
item := t.nextItem()
if t.error != nil {
break
}
if len(item) == 0 {
t.parseError("missing .end for .section");
break;
t.parseError("missing .end for .section")
break
}
done, tok, w := t.parseSimple(item);
done, tok, w := t.parseSimple(item)
if t.error != nil {
break
}
@ -544,10 +544,10 @@ Loop:
break Loop
case tokOr:
if s.or >= 0 {
t.parseError("extra .or in .section");
break Loop;
t.parseError("extra .or in .section")
break Loop
}
s.or = t.elems.Len();
s.or = t.elems.Len()
case tokSection:
t.parseSection(w)
case tokRepeated:
@ -561,20 +561,20 @@ Loop:
if t.error != nil {
return nil
}
s.end = t.elems.Len();
return s;
s.end = t.elems.Len()
return s
}
func (t *Template) parse() {
for t.error == nil {
item := t.nextItem();
item := t.nextItem()
if t.error != nil {
break
}
if len(item) == 0 {
break
}
done, tok, w := t.parseSimple(item);
done, tok, w := t.parseSimple(item)
if done {
continue
}
@ -603,34 +603,34 @@ func (st *state) findVar(s string) reflect.Value {
if s == "@" {
return st.data
}
data := st.data;
elems := strings.Split(s, ".", 0);
data := st.data
elems := strings.Split(s, ".", 0)
for i := 0; i < len(elems); i++ {
// Look up field; data must be a struct or map.
data = reflect.Indirect(data);
data = reflect.Indirect(data)
if data == nil {
return nil
}
switch typ := data.Type().(type) {
case *reflect.StructType:
field, ok := typ.FieldByName(elems[i]);
field, ok := typ.FieldByName(elems[i])
if !ok {
return nil
}
data = data.(*reflect.StructValue).FieldByIndex(field.Index);
data = data.(*reflect.StructValue).FieldByIndex(field.Index)
case *reflect.MapType:
data = data.(*reflect.MapValue).Elem(reflect.NewValue(elems[i]))
default:
return nil
}
}
return data;
return data
}
// Is there no data to look at?
func empty(v reflect.Value) bool {
v = reflect.Indirect(v);
v = reflect.Indirect(v)
if v == nil {
return true
}
@ -646,63 +646,63 @@ func empty(v reflect.Value) bool {
case *reflect.SliceValue:
return v.Len() == 0
}
return true;
return true
}
// Look up a variable, up through the parent if necessary.
func (t *Template) varValue(name string, st *state) reflect.Value {
field := st.findVar(name);
field := st.findVar(name)
if field == nil {
if st.parent == nil {
t.execError(st, t.linenum, "name not found: %s", name)
}
return t.varValue(name, st.parent);
return t.varValue(name, st.parent)
}
return field;
return field
}
// Evaluate a variable, looking up through the parent if necessary.
// If it has a formatter attached ({var|formatter}) run that too.
func (t *Template) writeVariable(v *variableElement, st *state) {
formatter := v.formatter;
val := t.varValue(v.name, st).Interface();
formatter := v.formatter
val := t.varValue(v.name, st).Interface()
// is it in user-supplied map?
if t.fmap != nil {
if fn, ok := t.fmap[formatter]; ok {
fn(st.wr, val, formatter);
return;
fn(st.wr, val, formatter)
return
}
}
// is it in builtin map?
if fn, ok := builtins[formatter]; ok {
fn(st.wr, val, formatter);
return;
fn(st.wr, val, formatter)
return
}
t.execError(st, v.linenum, "missing formatter %s for variable %s", formatter, v.name);
t.execError(st, v.linenum, "missing formatter %s for variable %s", formatter, v.name)
}
// Execute element i. Return next index to execute.
func (t *Template) executeElement(i int, st *state) int {
switch elem := t.elems.At(i).(type) {
case *textElement:
st.wr.Write(elem.text);
return i + 1;
st.wr.Write(elem.text)
return i + 1
case *literalElement:
st.wr.Write(elem.text);
return i + 1;
st.wr.Write(elem.text)
return i + 1
case *variableElement:
t.writeVariable(elem, st);
return i + 1;
t.writeVariable(elem, st)
return i + 1
case *sectionElement:
t.executeSection(elem, st);
return elem.end;
t.executeSection(elem, st)
return elem.end
case *repeatedElement:
t.executeRepeated(elem, st);
return elem.end;
t.executeRepeated(elem, st)
return elem.end
}
e := t.elems.At(i);
t.execError(st, 0, "internal error: bad directive in execute: %v %T\n", reflect.NewValue(e).Interface(), e);
return 0;
e := t.elems.At(i)
t.execError(st, 0, "internal error: bad directive in execute: %v %T\n", reflect.NewValue(e).Interface(), e)
return 0
}
// Execute the template.
@ -715,12 +715,12 @@ func (t *Template) execute(start, end int, st *state) {
// Execute a .section
func (t *Template) executeSection(s *sectionElement, st *state) {
// Find driver data for this section. It must be in the current struct.
field := t.varValue(s.field, st);
field := t.varValue(s.field, st)
if field == nil {
t.execError(st, s.linenum, ".section: cannot find field %s in %s", s.field, reflect.Indirect(st.data).Type())
}
st = st.clone(field);
start, end := s.start, s.or;
st = st.clone(field)
start, end := s.start, s.or
if !empty(field) {
// Execute the normal block.
if end < 0 {
@ -728,7 +728,7 @@ func (t *Template) executeSection(s *sectionElement, st *state) {
}
} else {
// Execute the .or block. If it's missing, do nothing.
start, end = s.or, s.end;
start, end = s.or, s.end
if start < 0 {
return
}
@ -741,42 +741,42 @@ func (t *Template) executeSection(s *sectionElement, st *state) {
// Return the result of calling the Iter method on v, or nil.
func iter(v reflect.Value) *reflect.ChanValue {
for j := 0; j < v.Type().NumMethod(); j++ {
mth := v.Type().Method(j);
fv := v.Method(j);
ft := fv.Type().(*reflect.FuncType);
mth := v.Type().Method(j)
fv := v.Method(j)
ft := fv.Type().(*reflect.FuncType)
// TODO(rsc): NumIn() should return 0 here, because ft is from a curried FuncValue.
if mth.Name != "Iter" || ft.NumIn() != 1 || ft.NumOut() != 1 {
continue
}
ct, ok := ft.Out(0).(*reflect.ChanType);
ct, ok := ft.Out(0).(*reflect.ChanType)
if !ok || ct.Dir()&reflect.RecvDir == 0 {
continue
}
return fv.Call(nil)[0].(*reflect.ChanValue);
return fv.Call(nil)[0].(*reflect.ChanValue)
}
return nil;
return nil
}
// Execute a .repeated section
func (t *Template) executeRepeated(r *repeatedElement, st *state) {
// Find driver data for this section. It must be in the current struct.
field := t.varValue(r.field, st);
field := t.varValue(r.field, st)
if field == nil {
t.execError(st, r.linenum, ".repeated: cannot find field %s in %s", r.field, reflect.Indirect(st.data).Type())
}
start, end := r.start, r.or;
start, end := r.start, r.or
if end < 0 {
end = r.end
}
if r.altstart >= 0 {
end = r.altstart
}
first := true;
first := true
if array, ok := field.(reflect.ArrayOrSliceValue); ok {
for j := 0; j < array.Len(); j++ {
newst := st.clone(array.Elem(j));
newst := st.clone(array.Elem(j))
// .alternates between elements
if !first && r.altstart >= 0 {
@ -784,7 +784,7 @@ func (t *Template) executeRepeated(r *repeatedElement, st *state) {
i = t.executeElement(i, newst)
}
}
first = false;
first = false
for i := start; i < end; {
i = t.executeElement(i, newst)
@ -792,11 +792,11 @@ func (t *Template) executeRepeated(r *repeatedElement, st *state) {
}
} else if ch := iter(field); ch != nil {
for {
e := ch.Recv();
e := ch.Recv()
if ch.Closed() {
break
}
newst := st.clone(e);
newst := st.clone(e)
// .alternates between elements
if !first && r.altstart >= 0 {
@ -804,7 +804,7 @@ func (t *Template) executeRepeated(r *repeatedElement, st *state) {
i = t.executeElement(i, newst)
}
}
first = false;
first = false
for i := start; i < end; {
i = t.executeElement(i, newst)
@ -817,14 +817,14 @@ func (t *Template) executeRepeated(r *repeatedElement, st *state) {
if first {
// Empty. Execute the .or block, once. If it's missing, do nothing.
start, end := r.or, r.end;
start, end := r.or, r.end
if start >= 0 {
newst := st.clone(field);
newst := st.clone(field)
for i := start; i < end; {
i = t.executeElement(i, newst)
}
}
return;
return
}
}
@ -838,7 +838,7 @@ func validDelim(d []byte) bool {
return false
}
}
return true;
return true
}
// -- Public interface
@ -853,25 +853,25 @@ func (t *Template) Parse(s string) os.Error {
if !validDelim(t.ldelim) || !validDelim(t.rdelim) {
return &Error{1, fmt.Sprintf("bad delimiter strings %q %q", t.ldelim, t.rdelim)}
}
t.buf = strings.Bytes(s);
t.p = 0;
t.linenum = 1;
t.parse();
return t.error;
t.buf = strings.Bytes(s)
t.p = 0
t.linenum = 1
t.parse()
return t.error
}
// Execute applies a parsed template to the specified data object,
// generating output to wr.
func (t *Template) Execute(data interface{}, wr io.Writer) os.Error {
// Extract the driver data.
val := reflect.NewValue(data);
errors := make(chan os.Error);
val := reflect.NewValue(data)
errors := make(chan os.Error)
go func() {
t.p = 0;
t.execute(0, t.elems.Len(), &state{nil, val, wr, errors});
errors <- nil; // clean return;
}();
return <-errors;
t.p = 0
t.execute(0, t.elems.Len(), &state{nil, val, wr, errors})
errors <- nil // clean return;
}()
return <-errors
}
// SetDelims sets the left and right delimiters for operations in the
@ -880,8 +880,8 @@ func (t *Template) Execute(data interface{}, wr io.Writer) os.Error {
// delimiters are very rarely invalid and Parse has the necessary
// error-handling interface already.
func (t *Template) SetDelims(left, right string) {
t.ldelim = strings.Bytes(left);
t.rdelim = strings.Bytes(right);
t.ldelim = strings.Bytes(left)
t.rdelim = strings.Bytes(right)
}
// Parse creates a Template with default parameters (such as {} for
@ -890,19 +890,19 @@ func (t *Template) SetDelims(left, right string) {
// for formatting variables. The template is returned. If any errors
// occur, err will be non-nil.
func Parse(s string, fmap FormatterMap) (t *Template, err os.Error) {
t = New(fmap);
err = t.Parse(s);
t = New(fmap)
err = t.Parse(s)
if err != nil {
t = nil
}
return;
return
}
// MustParse is like Parse but panics if the template cannot be parsed.
func MustParse(s string, fmap FormatterMap) *Template {
t, err := Parse(s, fmap);
t, err := Parse(s, fmap)
if err != nil {
panic("template parse error: ", err.String())
}
return t;
return t
}

192
src/pkg/template/template_test.go
View file

@ -5,65 +5,65 @@
package template
import (
"bytes";
"container/vector";
"fmt";
"io";
"strings";
"testing";
"bytes"
"container/vector"
"fmt"
"io"
"strings"
"testing"
)
type Test struct {
in, out, err string;
in, out, err string
}
type T struct {
item string;
value string;
item string
value string
}
type U struct {
mp map[string]int;
mp map[string]int
}
type S struct {
header string;
integer int;
raw string;
innerT T;
innerPointerT *T;
data []T;
pdata []*T;
empty []*T;
emptystring string;
null []*T;
vec *vector.Vector;
true bool;
false bool;
mp map[string]string;
innermap U;
bytes []byte;
header string
integer int
raw string
innerT T
innerPointerT *T
data []T
pdata []*T
empty []*T
emptystring string
null []*T
vec *vector.Vector
true bool
false bool
mp map[string]string
innermap U
bytes []byte
}
var t1 = T{"ItemNumber1", "ValueNumber1"}
var t2 = T{"ItemNumber2", "ValueNumber2"}
func uppercase(v interface{}) string {
s := v.(string);
t := "";
s := v.(string)
t := ""
for i := 0; i < len(s); i++ {
c := s[i];
c := s[i]
if 'a' <= c && c <= 'z' {
c = c + 'A' - 'a'
}
t += string(c);
t += string(c)
}
return t;
return t
}
func plus1(v interface{}) string {
i := v.(int);
return fmt.Sprint(i + 1);
i := v.(int)
return fmt.Sprint(i + 1)
}
func writer(f func(interface{}) string) (func(io.Writer, interface{}, string)) {
@ -306,36 +306,36 @@ var tests = []*Test{
}
func TestAll(t *testing.T) {
s := new(S);
s := new(S)
// initialized by hand for clarity.
s.header = "Header";
s.integer = 77;
s.raw = "&<>!@ #$%^";
s.innerT = t1;
s.data = []T{t1, t2};
s.pdata = []*T{&t1, &t2};
s.empty = []*T{};
s.null = nil;
s.vec = new(vector.Vector);
s.vec.Push("elt1");
s.vec.Push("elt2");
s.true = true;
s.false = false;
s.mp = make(map[string]string);
s.mp["mapkey"] = "Ahoy!";
s.innermap.mp = make(map[string]int);
s.innermap.mp["innerkey"] = 55;
s.bytes = strings.Bytes("hello");
s.header = "Header"
s.integer = 77
s.raw = "&<>!@ #$%^"
s.innerT = t1
s.data = []T{t1, t2}
s.pdata = []*T{&t1, &t2}
s.empty = []*T{}
s.null = nil
s.vec = new(vector.Vector)
s.vec.Push("elt1")
s.vec.Push("elt2")
s.true = true
s.false = false
s.mp = make(map[string]string)
s.mp["mapkey"] = "Ahoy!"
s.innermap.mp = make(map[string]int)
s.innermap.mp["innerkey"] = 55
s.bytes = strings.Bytes("hello")
var buf bytes.Buffer;
var buf bytes.Buffer
for _, test := range tests {
buf.Reset();
tmpl, err := Parse(test.in, formatters);
buf.Reset()
tmpl, err := Parse(test.in, formatters)
if err != nil {
t.Error("unexpected parse error:", err);
continue;
t.Error("unexpected parse error:", err)
continue
}
err = tmpl.Execute(s, &buf);
err = tmpl.Execute(s, &buf)
if test.err == "" {
if err != nil {
t.Error("unexpected execute error:", err)
@ -352,60 +352,60 @@ func TestAll(t *testing.T) {
}
func TestMapDriverType(t *testing.T) {
mp := map[string]string{"footer": "Ahoy!"};
tmpl, err := Parse("template: {footer}", nil);
mp := map[string]string{"footer": "Ahoy!"}
tmpl, err := Parse("template: {footer}", nil)
if err != nil {
t.Error("unexpected parse error:", err)
}
var b bytes.Buffer;
err = tmpl.Execute(mp, &b);
var b bytes.Buffer
err = tmpl.Execute(mp, &b)
if err != nil {
t.Error("unexpected execute error:", err)
}
s := b.String();
expected := "template: Ahoy!";
s := b.String()
expected := "template: Ahoy!"
if s != expected {
t.Errorf("failed passing string as data: expected %q got %q", "template: Ahoy!", s)
}
}
func TestStringDriverType(t *testing.T) {
tmpl, err := Parse("template: {@}", nil);
tmpl, err := Parse("template: {@}", nil)
if err != nil {
t.Error("unexpected parse error:", err)
}
var b bytes.Buffer;
err = tmpl.Execute("hello", &b);
var b bytes.Buffer
err = tmpl.Execute("hello", &b)
if err != nil {
t.Error("unexpected execute error:", err)
}
s := b.String();
s := b.String()
if s != "template: hello" {
t.Errorf("failed passing string as data: expected %q got %q", "template: hello", s)
}
}
func TestTwice(t *testing.T) {
tmpl, err := Parse("template: {@}", nil);
tmpl, err := Parse("template: {@}", nil)
if err != nil {
t.Error("unexpected parse error:", err)
}
var b bytes.Buffer;
err = tmpl.Execute("hello", &b);
var b bytes.Buffer
err = tmpl.Execute("hello", &b)
if err != nil {
t.Error("unexpected parse error:", err)
}
s := b.String();
text := "template: hello";
s := b.String()
text := "template: hello"
if s != text {
t.Errorf("failed passing string as data: expected %q got %q", text, s)
}
err = tmpl.Execute("hello", &b);
err = tmpl.Execute("hello", &b)
if err != nil {
t.Error("unexpected parse error:", err)
}
s = b.String();
text += text;
s = b.String()
text += text
if s != text {
t.Errorf("failed passing string as data: expected %q got %q", text, s)
}
@ -415,29 +415,29 @@ func TestCustomDelims(t *testing.T) {
// try various lengths. zero should catch error.
for i := 0; i < 7; i++ {
for j := 0; j < 7; j++ {
tmpl := New(nil);
tmpl := New(nil)
// first two chars deliberately the same to test equal left and right delims
ldelim := "$!#$%^&"[0:i];
rdelim := "$*&^%$!"[0:j];
tmpl.SetDelims(ldelim, rdelim);
ldelim := "$!#$%^&"[0:i]
rdelim := "$*&^%$!"[0:j]
tmpl.SetDelims(ldelim, rdelim)
// if braces, this would be template: {@}{.meta-left}{.meta-right}
text := "template: " +
ldelim + "@" + rdelim +
ldelim + ".meta-left" + rdelim +
ldelim + ".meta-right" + rdelim;
err := tmpl.Parse(text);
ldelim + ".meta-right" + rdelim
err := tmpl.Parse(text)
if err != nil {
if i == 0 || j == 0 { // expected
if i == 0 || j == 0 { // expected
continue
}
t.Error("unexpected parse error:", err);
t.Error("unexpected parse error:", err)
} else if i == 0 || j == 0 {
t.Errorf("expected parse error for empty delimiter: %d %d %q %q", i, j, ldelim, rdelim);
continue;
t.Errorf("expected parse error for empty delimiter: %d %d %q %q", i, j, ldelim, rdelim)
continue
}
var b bytes.Buffer;
err = tmpl.Execute("hello", &b);
s := b.String();
var b bytes.Buffer
err = tmpl.Execute("hello", &b)
s := b.String()
if s != "template: hello"+ldelim+rdelim {
t.Errorf("failed delim check(%q %q) %q got %q", ldelim, rdelim, text, s)
}
@ -447,21 +447,21 @@ func TestCustomDelims(t *testing.T) {
// Test that a variable evaluates to the field itself and does not further indirection
func TestVarIndirection(t *testing.T) {
s := new(S);
s := new(S)
// initialized by hand for clarity.
s.innerPointerT = &t1;
s.innerPointerT = &t1
var buf bytes.Buffer;
input := "{.section @}{innerPointerT}{.end}";
tmpl, err := Parse(input, nil);
var buf bytes.Buffer
input := "{.section @}{innerPointerT}{.end}"
tmpl, err := Parse(input, nil)
if err != nil {
t.Fatal("unexpected parse error:", err)
}
err = tmpl.Execute(s, &buf);
err = tmpl.Execute(s, &buf)
if err != nil {
t.Fatal("unexpected execute error:", err)
}
expect := fmt.Sprintf("%v", &t1); // output should be hex address of t1
expect := fmt.Sprintf("%v", &t1) // output should be hex address of t1
if buf.String() != expect {
t.Errorf("for %q: expected %q got %q", input, expect, buf.String())
}

88
src/pkg/testing/benchmark.go
View file

@ -5,10 +5,10 @@
package testing
import (
"flag";
"fmt";
"os";
"time";
"flag"
"fmt"
"os"
"time"
)
var matchBenchmarks = flag.String("benchmarks", "", "regular expression to select benchmarks to run")
@ -16,24 +16,24 @@ var matchBenchmarks = flag.String("benchmarks", "", "regular expression to selec
// An internal type but exported because it is cross-package; part of the implementation
// of gotest.
type Benchmark struct {
Name string;
F func(b *B);
Name string
F func(b *B)
}
// B is a type passed to Benchmark functions to manage benchmark
// timing and to specify the number of iterations to run.
type B struct {
N int;
benchmark Benchmark;
ns int64;
bytes int64;
start int64;
N int
benchmark Benchmark
ns int64
bytes int64
start int64
}
// StartTimer starts timing a test. This function is called automatically
// before a benchmark starts, but it can also used to resume timing after
// a call to StopTimer.
func (b *B) StartTimer() { b.start = time.Nanoseconds() }
func (b *B) StartTimer() { b.start = time.Nanoseconds() }
// StopTimer stops timing a test. This can be used to pause the timer
// while performing complex initialization that you don't
@ -42,68 +42,68 @@ func (b *B) StopTimer() {
if b.start > 0 {
b.ns += time.Nanoseconds() - b.start
}
b.start = 0;
b.start = 0
}
// ResetTimer stops the timer and sets the elapsed benchmark time to zero.
func (b *B) ResetTimer() {
b.start = 0;
b.ns = 0;
b.start = 0
b.ns = 0
}
// SetBytes records the number of bytes processed in a single operation.
// If this is called, the benchmark will report ns/op and MB/s.
func (b *B) SetBytes(n int64) { b.bytes = n }
func (b *B) SetBytes(n int64) { b.bytes = n }
func (b *B) nsPerOp() int64 {
if b.N <= 0 {
return 0
}
return b.ns / int64(b.N);
return b.ns / int64(b.N)
}
// runN runs a single benchmark for the specified number of iterations.
func (b *B) runN(n int) {
b.N = n;
b.ResetTimer();
b.StartTimer();
b.benchmark.F(b);
b.StopTimer();
b.N = n
b.ResetTimer()
b.StartTimer()
b.benchmark.F(b)
b.StopTimer()
}
func min(x, y int) int {
if x > y {
return y
}
return x;
return x
}
// roundDown10 rounds a number down to the nearest power of 10.
func roundDown10(n int) int {
var tens = 0;
var tens = 0
// tens = floor(log_10(n))
for n > 10 {
n = n / 10;
tens++;
n = n / 10
tens++
}
// result = 10^tens
result := 1;
result := 1
for i := 0; i < tens; i++ {
result *= 10
}
return result;
return result
}
// roundUp rounds x up to a number of the form [1eX, 2eX, 5eX].
func roundUp(n int) int {
base := roundDown10(n);
base := roundDown10(n)
if n < (2 * base) {
return 2 * base
}
if n < (5 * base) {
return 5 * base
}
return 10 * base;
return 10 * base
}
// run times the benchmark function. It gradually increases the number
@ -112,11 +112,11 @@ func roundUp(n int) int {
// testing.BenchmarkHello 100000 19 ns/op
func (b *B) run() {
// Run the benchmark for a single iteration in case it's expensive.
n := 1;
b.runN(n);
n := 1
b.runN(n)
// Run the benchmark for at least a second.
for b.ns < 1e9 && n < 1e9 {
last := n;
last := n
// Predict iterations/sec.
if b.nsPerOp() == 0 {
n = 1e9
@ -125,17 +125,17 @@ func (b *B) run() {
}
// Run more iterations than we think we'll need for a second (1.5x).
// Don't grow too fast in case we had timing errors previously.
n = min(int(1.5*float(n)), 100*last);
n = min(int(1.5*float(n)), 100*last)
// Round up to something easy to read.
n = roundUp(n);
b.runN(n);
n = roundUp(n)
b.runN(n)
}
ns := b.nsPerOp();
mb := "";
ns := b.nsPerOp()
mb := ""
if ns > 0 && b.bytes > 0 {
mb = fmt.Sprintf("\t%7.2f MB/s", (float64(b.bytes)/1e6)/(float64(ns)/1e9))
}
fmt.Printf("%s\t%8d\t%10d ns/op%s\n", b.benchmark.Name, b.N, b.nsPerOp(), mb);
fmt.Printf("%s\t%8d\t%10d ns/op%s\n", b.benchmark.Name, b.N, b.nsPerOp(), mb)
}
// An internal function but exported because it is cross-package; part of the implementation
@ -145,16 +145,16 @@ func RunBenchmarks(benchmarks []Benchmark) {
if len(*matchBenchmarks) == 0 {
return
}
re, err := CompileRegexp(*matchBenchmarks);
re, err := CompileRegexp(*matchBenchmarks)
if err != "" {
println("invalid regexp for -benchmarks:", err);
os.Exit(1);
println("invalid regexp for -benchmarks:", err)
os.Exit(1)
}
for _, Benchmark := range benchmarks {
if !re.MatchString(Benchmark.Name) {
continue
}
b := &B{benchmark: Benchmark};
b.run();
b := &B{benchmark: Benchmark}
b.run()
}
}

22
src/pkg/testing/iotest/logger.go
View file

@ -5,24 +5,24 @@
package iotest
import (
"io";
"log";
"os";
"io"
"log"
"os"
)
type writeLogger struct {
prefix string;
w io.Writer;
prefix string
w io.Writer
}
func (l *writeLogger) Write(p []byte) (n int, err os.Error) {
n, err = l.w.Write(p);
n, err = l.w.Write(p)
if err != nil {
log.Stdoutf("%s %x: %v", l.prefix, p[0:n], err)
} else {
log.Stdoutf("%s %x", l.prefix, p[0:n])
}
return;
return
}
// NewWriteLogger returns a writer that behaves like w except
@ -33,18 +33,18 @@ func NewWriteLogger(prefix string, w io.Writer) io.Writer {
}
type readLogger struct {
prefix string;
r io.Reader;
prefix string
r io.Reader
}
func (l *readLogger) Read(p []byte) (n int, err os.Error) {
n, err = l.r.Read(p);
n, err = l.r.Read(p)
if err != nil {
log.Stdoutf("%s %x: %v", l.prefix, p[0:n], err)
} else {
log.Stdoutf("%s %x", l.prefix, p[0:n])
}
return;
return
}
// NewReadLogger returns a reader that behaves like r except

34
src/pkg/testing/iotest/reader.go
View file

@ -7,31 +7,31 @@
package iotest
import (
"io";
"os";
"io"
"os"
)
// OneByteReader returns a Reader that implements
// each non-empty Read by reading one byte from r.
func OneByteReader(r io.Reader) io.Reader { return &oneByteReader{r} }
func OneByteReader(r io.Reader) io.Reader { return &oneByteReader{r} }
type oneByteReader struct {
r io.Reader;
r io.Reader
}
func (r *oneByteReader) Read(p []byte) (int, os.Error) {
if len(p) == 0 {
return 0, nil
}
return r.r.Read(p[0:1]);
return r.r.Read(p[0:1])
}
// HalfReader returns a Reader that implements Read
// by reading half as many requested bytes from r.
func HalfReader(r io.Reader) io.Reader { return &halfReader{r} }
func HalfReader(r io.Reader) io.Reader { return &halfReader{r} }
type halfReader struct {
r io.Reader;
r io.Reader
}
func (r *halfReader) Read(p []byte) (int, os.Error) {
@ -42,12 +42,12 @@ func (r *halfReader) Read(p []byte) (int, os.Error) {
// DataErrReader returns a Reader that returns the final
// error with the last data read, instead of by itself with
// zero bytes of data.
func DataErrReader(r io.Reader) io.Reader { return &dataErrReader{r, nil, make([]byte, 1024)} }
func DataErrReader(r io.Reader) io.Reader { return &dataErrReader{r, nil, make([]byte, 1024)} }
type dataErrReader struct {
r io.Reader;
unread []byte;
data []byte;
r io.Reader
unread []byte
data []byte
}
func (r *dataErrReader) Read(p []byte) (n int, err os.Error) {
@ -55,15 +55,15 @@ func (r *dataErrReader) Read(p []byte) (n int, err os.Error) {
// one to get data and a second to look for an error.
for {
if len(r.unread) == 0 {
n1, err1 := r.r.Read(r.data);
r.unread = r.data[0:n1];
err = err1;
n1, err1 := r.r.Read(r.data)
r.unread = r.data[0:n1]
err = err1
}
if n > 0 {
break
}
n = copy(p, r.unread);
r.unread = r.unread[n:];
n = copy(p, r.unread)
r.unread = r.unread[n:]
}
return;
return
}

16
src/pkg/testing/iotest/writer.go
View file

@ -5,8 +5,8 @@
package iotest
import (
"io";
"os";
"io"
"os"
)
// TruncateWriter returns a Writer that writes to w
@ -16,8 +16,8 @@ func TruncateWriter(w io.Writer, n int64) io.Writer {
}
type truncateWriter struct {
w io.Writer;
n int64;
w io.Writer
n int64
}
func (t *truncateWriter) Write(p []byte) (n int, err os.Error) {
@ -25,14 +25,14 @@ func (t *truncateWriter) Write(p []byte) (n int, err os.Error) {
return len(p), nil
}
// real write
n = len(p);
n = len(p)
if int64(n) > t.n {
n = int(t.n)
}
n, err = t.w.Write(p[0:n]);
t.n -= int64(n);
n, err = t.w.Write(p[0:n])
t.n -= int64(n)
if err == nil {
n = len(p)
}
return;
return
}

188
src/pkg/testing/quick/quick.go
View file

@ -6,13 +6,13 @@
package quick
import (
"flag";
"fmt";
"math";
"os";
"rand";
"reflect";
"strings";
"flag"
"fmt"
"math"
"os"
"rand"
"reflect"
"strings"
)
var defaultMaxCount *int = flag.Int("quickchecks", 100, "The default number of iterations for each check")
@ -21,29 +21,29 @@ var defaultMaxCount *int = flag.Int("quickchecks", 100, "The default number of i
type Generator interface {
// Generate returns a random instance of the type on which it is a
// method using the size as a size hint.
Generate(rand *rand.Rand, size int) reflect.Value;
Generate(rand *rand.Rand, size int) reflect.Value
}
// randFloat32 generates a random float taking the full range of a float32.
func randFloat32(rand *rand.Rand) float32 {
f := rand.Float64() * math.MaxFloat32;
f := rand.Float64() * math.MaxFloat32
if rand.Int()&1 == 1 {
f = -f
}
return float32(f);
return float32(f)
}
// randFloat64 generates a random float taking the full range of a float64.
func randFloat64(rand *rand.Rand) float64 {
f := rand.Float64();
f := rand.Float64()
if rand.Int()&1 == 1 {
f = -f
}
return f;
return f
}
// randInt64 returns a random integer taking half the range of an int64.
func randInt64(rand *rand.Rand) int64 { return rand.Int63() - 1<<62 }
func randInt64(rand *rand.Rand) int64 { return rand.Int63() - 1<<62 }
// complexSize is the maximum length of arbitrary values that contain other
// values.
@ -81,53 +81,53 @@ func Value(t reflect.Type, rand *rand.Rand) (value reflect.Value, ok bool) {
case *reflect.IntType:
return reflect.NewValue(int(randInt64(rand))), true
case *reflect.MapType:
numElems := rand.Intn(complexSize);
m := reflect.MakeMap(concrete);
numElems := rand.Intn(complexSize)
m := reflect.MakeMap(concrete)
for i := 0; i < numElems; i++ {
key, ok1 := Value(concrete.Key(), rand);
value, ok2 := Value(concrete.Elem(), rand);
key, ok1 := Value(concrete.Key(), rand)
value, ok2 := Value(concrete.Elem(), rand)
if !ok1 || !ok2 {
return nil, false
}
m.SetElem(key, value);
m.SetElem(key, value)
}
return m, true;
return m, true
case *reflect.PtrType:
v, ok := Value(concrete.Elem(), rand);
v, ok := Value(concrete.Elem(), rand)
if !ok {
return nil, false
}
p := reflect.MakeZero(concrete);
p.(*reflect.PtrValue).PointTo(v);
return p, true;
p := reflect.MakeZero(concrete)
p.(*reflect.PtrValue).PointTo(v)
return p, true
case *reflect.SliceType:
numElems := rand.Intn(complexSize);
s := reflect.MakeSlice(concrete, numElems, numElems);
numElems := rand.Intn(complexSize)
s := reflect.MakeSlice(concrete, numElems, numElems)
for i := 0; i < numElems; i++ {
v, ok := Value(concrete.Elem(), rand);
v, ok := Value(concrete.Elem(), rand)
if !ok {
return nil, false
}
s.Elem(i).SetValue(v);
s.Elem(i).SetValue(v)
}
return s, true;
return s, true
case *reflect.StringType:
numChars := rand.Intn(complexSize);
codePoints := make([]int, numChars);
numChars := rand.Intn(complexSize)
codePoints := make([]int, numChars)
for i := 0; i < numChars; i++ {
codePoints[i] = rand.Intn(0x10ffff)
}
return reflect.NewValue(string(codePoints)), true;
return reflect.NewValue(string(codePoints)), true
case *reflect.StructType:
s := reflect.MakeZero(t).(*reflect.StructValue);
s := reflect.MakeZero(t).(*reflect.StructValue)
for i := 0; i < s.NumField(); i++ {
v, ok := Value(concrete.Field(i).Type, rand);
v, ok := Value(concrete.Field(i).Type, rand)
if !ok {
return nil, false
}
s.Field(i).SetValue(v);
s.Field(i).SetValue(v)
}
return s, true;
return s, true
case *reflect.Uint16Type:
return reflect.NewValue(uint16(randInt64(rand))), true
case *reflect.Uint32Type:
@ -144,24 +144,24 @@ func Value(t reflect.Type, rand *rand.Rand) (value reflect.Value, ok bool) {
return nil, false
}
return;
return
}
// A Config structure contains options for running a test.
type Config struct {
// MaxCount sets the maximum number of iterations. If zero,
// MaxCountScale is used.
MaxCount int;
MaxCount int
// MaxCountScale is a non-negative scale factor applied to the default
// maximum. If zero, the default is unchanged.
MaxCountScale float;
MaxCountScale float
// If non-nil, rand is a source of random numbers. Otherwise a default
// pseudo-random source will be used.
Rand *rand.Rand;
Rand *rand.Rand
// If non-nil, Values is a function which generates a slice of arbitrary
// Values that are congruent with the arguments to the function being
// tested. Otherwise, Values is used to generate the values.
Values func([]reflect.Value, *rand.Rand);
Values func([]reflect.Value, *rand.Rand)
}
var defaultConfig Config
@ -171,13 +171,13 @@ func (c *Config) getRand() *rand.Rand {
if c.Rand == nil {
return rand.New(rand.NewSource(0))
}
return c.Rand;
return c.Rand
}
// getMaxCount returns the maximum number of iterations to run for a given
// Config.
func (c *Config) getMaxCount() (maxCount int) {
maxCount = c.MaxCount;
maxCount = c.MaxCount
if maxCount == 0 {
if c.MaxCountScale != 0 {
maxCount = int(c.MaxCountScale * float(*defaultMaxCount))
@ -186,19 +186,19 @@ func (c *Config) getMaxCount() (maxCount int) {
}
}
return;
return
}
// A SetupError is the result of an error in the way that check is being
// used, independent of the functions being tested.
type SetupError string
func (s SetupError) String() string { return string(s) }
func (s SetupError) String() string { return string(s) }
// A CheckError is the result of Check finding an error.
type CheckError struct {
Count int;
In []interface{};
Count int
In []interface{}
}
func (s *CheckError) String() string {
@ -207,9 +207,9 @@ func (s *CheckError) String() string {
// A CheckEqualError is the result CheckEqual finding an error.
type CheckEqualError struct {
CheckError;
Out1 []interface{};
Out2 []interface{};
CheckError
Out1 []interface{}
Out2 []interface{}
}
func (s *CheckEqualError) String() string {
@ -236,38 +236,38 @@ func Check(function interface{}, config *Config) (err os.Error) {
config = &defaultConfig
}
f, fType, ok := functionAndType(function);
f, fType, ok := functionAndType(function)
if !ok {
err = SetupError("argument is not a function");
return;
err = SetupError("argument is not a function")
return
}
if fType.NumOut() != 1 {
err = SetupError("function returns more than one value.");
return;
err = SetupError("function returns more than one value.")
return
}
if _, ok := fType.Out(0).(*reflect.BoolType); !ok {
err = SetupError("function does not return a bool");
return;
err = SetupError("function does not return a bool")
return
}
arguments := make([]reflect.Value, fType.NumIn());
rand := config.getRand();
maxCount := config.getMaxCount();
arguments := make([]reflect.Value, fType.NumIn())
rand := config.getRand()
maxCount := config.getMaxCount()
for i := 0; i < maxCount; i++ {
err = arbitraryValues(arguments, fType, config, rand);
err = arbitraryValues(arguments, fType, config, rand)
if err != nil {
return
}
if !f.Call(arguments)[0].(*reflect.BoolValue).Get() {
err = &CheckError{i + 1, toInterfaces(arguments)};
return;
err = &CheckError{i + 1, toInterfaces(arguments)}
return
}
}
return;
return
}
// CheckEqual looks for an input on which f and g return different results.
@ -279,85 +279,85 @@ func CheckEqual(f, g interface{}, config *Config) (err os.Error) {
config = &defaultConfig
}
x, xType, ok := functionAndType(f);
x, xType, ok := functionAndType(f)
if !ok {
err = SetupError("f is not a function");
return;
err = SetupError("f is not a function")
return
}
y, yType, ok := functionAndType(g);
y, yType, ok := functionAndType(g)
if !ok {
err = SetupError("g is not a function");
return;
err = SetupError("g is not a function")
return
}
if xType != yType {
err = SetupError("functions have different types");
return;
err = SetupError("functions have different types")
return
}
arguments := make([]reflect.Value, xType.NumIn());
rand := config.getRand();
maxCount := config.getMaxCount();
arguments := make([]reflect.Value, xType.NumIn())
rand := config.getRand()
maxCount := config.getMaxCount()
for i := 0; i < maxCount; i++ {
err = arbitraryValues(arguments, xType, config, rand);
err = arbitraryValues(arguments, xType, config, rand)
if err != nil {
return
}
xOut := toInterfaces(x.Call(arguments));
yOut := toInterfaces(y.Call(arguments));
xOut := toInterfaces(x.Call(arguments))
yOut := toInterfaces(y.Call(arguments))
if !reflect.DeepEqual(xOut, yOut) {
err = &CheckEqualError{CheckError{i + 1, toInterfaces(arguments)}, xOut, yOut};
return;
err = &CheckEqualError{CheckError{i + 1, toInterfaces(arguments)}, xOut, yOut}
return
}
}
return;
return
}
// arbitraryValues writes Values to args such that args contains Values
// suitable for calling f.
func arbitraryValues(args []reflect.Value, f *reflect.FuncType, config *Config, rand *rand.Rand) (err os.Error) {
if config.Values != nil {
config.Values(args, rand);
return;
config.Values(args, rand)
return
}
for j := 0; j < len(args); j++ {
var ok bool;
args[j], ok = Value(f.In(j), rand);
var ok bool
args[j], ok = Value(f.In(j), rand)
if !ok {
err = SetupError(fmt.Sprintf("cannot create arbitrary value of type %s for argument %d", f.In(j), j));
return;
err = SetupError(fmt.Sprintf("cannot create arbitrary value of type %s for argument %d", f.In(j), j))
return
}
}
return;
return
}
func functionAndType(f interface{}) (v *reflect.FuncValue, t *reflect.FuncType, ok bool) {
v, ok = reflect.NewValue(f).(*reflect.FuncValue);
v, ok = reflect.NewValue(f).(*reflect.FuncValue)
if !ok {
return
}
t = v.Type().(*reflect.FuncType);
return;
t = v.Type().(*reflect.FuncType)
return
}
func toInterfaces(values []reflect.Value) []interface{} {
ret := make([]interface{}, len(values));
ret := make([]interface{}, len(values))
for i, v := range values {
ret[i] = v.Interface()
}
return ret;
return ret
}
func toString(interfaces []interface{}) string {
s := make([]string, len(interfaces));
s := make([]string, len(interfaces))
for i, v := range interfaces {
s[i] = fmt.Sprintf("%#v", v)
}
return strings.Join(s, ", ");
return strings.Join(s, ", ")
}

114
src/pkg/testing/quick/quick_test.go
View file

@ -5,60 +5,60 @@
package quick
import (
"rand";
"reflect";
"testing";
"os";
"rand"
"reflect"
"testing"
"os"
)
func fBool(a bool) bool { return a }
func fBool(a bool) bool { return a }
func fFloat32(a float32) float32 { return a }
func fFloat32(a float32) float32 { return a }
func fFloat64(a float64) float64 { return a }
func fFloat64(a float64) float64 { return a }
func fFloat(a float) float { return a }
func fFloat(a float) float { return a }
func fInt16(a int16) int16 { return a }
func fInt16(a int16) int16 { return a }
func fInt32(a int32) int32 { return a }
func fInt32(a int32) int32 { return a }
func fInt64(a int64) int64 { return a }
func fInt64(a int64) int64 { return a }
func fInt8(a int8) int8 { return a }
func fInt8(a int8) int8 { return a }
func fInt(a int) int { return a }
func fInt(a int) int { return a }
func fUInt8(a uint8) uint8 { return a }
func fUInt8(a uint8) uint8 { return a }
func fMap(a map[int]int) map[int]int { return a }
func fMap(a map[int]int) map[int]int { return a }
func fSlice(a []byte) []byte { return a }
func fSlice(a []byte) []byte { return a }
func fString(a string) string { return a }
func fString(a string) string { return a }
type TestStruct struct {
A int;
B string;
A int
B string
}
func fStruct(a TestStruct) TestStruct { return a }
func fStruct(a TestStruct) TestStruct { return a }
func fUint16(a uint16) uint16 { return a }
func fUint16(a uint16) uint16 { return a }
func fUint32(a uint32) uint32 { return a }
func fUint32(a uint32) uint32 { return a }
func fUint64(a uint64) uint64 { return a }
func fUint64(a uint64) uint64 { return a }
func fUint8(a uint8) uint8 { return a }
func fUint8(a uint8) uint8 { return a }
func fUint(a uint) uint { return a }
func fUint(a uint) uint { return a }
func fUintptr(a uintptr) uintptr { return a }
func fUintptr(a uintptr) uintptr { return a }
func fIntptr(a *int) *int {
b := *a;
return &b;
b := *a
return &b
}
func reportError(property string, err os.Error, t *testing.T) {
@ -68,49 +68,49 @@ func reportError(property string, err os.Error, t *testing.T) {
}
func TestCheckEqual(t *testing.T) {
reportError("fBool", CheckEqual(fBool, fBool, nil), t);
reportError("fFloat32", CheckEqual(fFloat32, fFloat32, nil), t);
reportError("fFloat64", CheckEqual(fFloat64, fFloat64, nil), t);
reportError("fFloat", CheckEqual(fFloat, fFloat, nil), t);
reportError("fInt16", CheckEqual(fInt16, fInt16, nil), t);
reportError("fInt32", CheckEqual(fInt32, fInt32, nil), t);
reportError("fInt64", CheckEqual(fInt64, fInt64, nil), t);
reportError("fInt8", CheckEqual(fInt8, fInt8, nil), t);
reportError("fInt", CheckEqual(fInt, fInt, nil), t);
reportError("fUInt8", CheckEqual(fUInt8, fUInt8, nil), t);
reportError("fInt32", CheckEqual(fInt32, fInt32, nil), t);
reportError("fMap", CheckEqual(fMap, fMap, nil), t);
reportError("fSlice", CheckEqual(fSlice, fSlice, nil), t);
reportError("fString", CheckEqual(fString, fString, nil), t);
reportError("fStruct", CheckEqual(fStruct, fStruct, nil), t);
reportError("fUint16", CheckEqual(fUint16, fUint16, nil), t);
reportError("fUint32", CheckEqual(fUint32, fUint32, nil), t);
reportError("fUint64", CheckEqual(fUint64, fUint64, nil), t);
reportError("fUint8", CheckEqual(fUint8, fUint8, nil), t);
reportError("fUint", CheckEqual(fUint, fUint, nil), t);
reportError("fUintptr", CheckEqual(fUintptr, fUintptr, nil), t);
reportError("fIntptr", CheckEqual(fIntptr, fIntptr, nil), t);
reportError("fBool", CheckEqual(fBool, fBool, nil), t)
reportError("fFloat32", CheckEqual(fFloat32, fFloat32, nil), t)
reportError("fFloat64", CheckEqual(fFloat64, fFloat64, nil), t)
reportError("fFloat", CheckEqual(fFloat, fFloat, nil), t)
reportError("fInt16", CheckEqual(fInt16, fInt16, nil), t)
reportError("fInt32", CheckEqual(fInt32, fInt32, nil), t)
reportError("fInt64", CheckEqual(fInt64, fInt64, nil), t)
reportError("fInt8", CheckEqual(fInt8, fInt8, nil), t)
reportError("fInt", CheckEqual(fInt, fInt, nil), t)
reportError("fUInt8", CheckEqual(fUInt8, fUInt8, nil), t)
reportError("fInt32", CheckEqual(fInt32, fInt32, nil), t)
reportError("fMap", CheckEqual(fMap, fMap, nil), t)
reportError("fSlice", CheckEqual(fSlice, fSlice, nil), t)
reportError("fString", CheckEqual(fString, fString, nil), t)
reportError("fStruct", CheckEqual(fStruct, fStruct, nil), t)
reportError("fUint16", CheckEqual(fUint16, fUint16, nil), t)
reportError("fUint32", CheckEqual(fUint32, fUint32, nil), t)
reportError("fUint64", CheckEqual(fUint64, fUint64, nil), t)
reportError("fUint8", CheckEqual(fUint8, fUint8, nil), t)
reportError("fUint", CheckEqual(fUint, fUint, nil), t)
reportError("fUintptr", CheckEqual(fUintptr, fUintptr, nil), t)
reportError("fIntptr", CheckEqual(fIntptr, fIntptr, nil), t)
}
// This tests that ArbitraryValue is working by checking that all the arbitrary
// values of type MyStruct have x = 42.
type myStruct struct {
x int;
x int
}
func (m myStruct) Generate(r *rand.Rand, _ int) reflect.Value {
return reflect.NewValue(myStruct{x: 42})
}
func myStructProperty(in myStruct) bool { return in.x == 42 }
func myStructProperty(in myStruct) bool { return in.x == 42 }
func TestCheckProperty(t *testing.T) {
reportError("myStructProperty", Check(myStructProperty, nil), t)
}
func TestFailure(t *testing.T) {
f := func(x int) bool { return false };
err := Check(f, nil);
f := func(x int) bool { return false }
err := Check(f, nil)
if err == nil {
t.Errorf("Check didn't return an error")
}
@ -118,7 +118,7 @@ func TestFailure(t *testing.T) {
t.Errorf("Error was not a CheckError: %s", err)
}
err = CheckEqual(fUint, fUint32, nil);
err = CheckEqual(fUint, fUint32, nil)
if err == nil {
t.Errorf("#1 CheckEqual didn't return an error")
}
@ -126,7 +126,7 @@ func TestFailure(t *testing.T) {
t.Errorf("#1 Error was not a SetupError: %s", err)
}
err = CheckEqual(func(x, y int) {}, func(x int) {}, nil);
err = CheckEqual(func(x, y int) {}, func(x int) {}, nil)
if err == nil {
t.Errorf("#2 CheckEqual didn't return an error")
}
@ -134,7 +134,7 @@ func TestFailure(t *testing.T) {
t.Errorf("#2 Error was not a SetupError: %s", err)
}
err = CheckEqual(func(x int) int { return 0 }, func(x int) int32 { return 0 }, nil);
err = CheckEqual(func(x int) int { return 0 }, func(x int) int32 { return 0 }, nil)
if err == nil {
t.Errorf("#3 CheckEqual didn't return an error")
}

680
src/pkg/testing/regexp.go
View file

File diff suppressed because it is too large Load diff

122
src/pkg/testing/regexp_test.go
View file

@ -5,7 +5,7 @@
package testing
import (
"strings";
"strings"
)
var good_re = []string{
@ -30,8 +30,8 @@ var good_re = []string{
// TODO: nice to do this with a map
type stringError struct {
re string;
err string;
re string
err string
}
var bad_re = []stringError{
@ -52,9 +52,9 @@ var bad_re = []stringError{
type vec []int
type tester struct {
re string;
text string;
match vec;
re string
text string
match vec
}
var matches = []tester{
@ -87,15 +87,15 @@ var matches = []tester{
}
func compileTest(t *T, expr string, error string) *Regexp {
re, err := CompileRegexp(expr);
re, err := CompileRegexp(expr)
if err != error {
t.Error("compiling `", expr, "`; unexpected error: ", err)
}
return re;
return re
}
func printVec(t *T, m []int) {
l := len(m);
l := len(m)
if l == 0 {
t.Log("\t<no match>")
} else {
@ -106,7 +106,7 @@ func printVec(t *T, m []int) {
}
func printStrings(t *T, m []string) {
l := len(m);
l := len(m)
if l == 0 {
t.Log("\t<no match>")
} else {
@ -117,7 +117,7 @@ func printStrings(t *T, m []string) {
}
func printBytes(t *T, b [][]byte) {
l := len(b);
l := len(b)
if l == 0 {
t.Log("\t<no match>")
} else {
@ -128,7 +128,7 @@ func printBytes(t *T, b [][]byte) {
}
func equal(m1, m2 []int) bool {
l := len(m1);
l := len(m1)
if l != len(m2) {
return false
}
@ -137,11 +137,11 @@ func equal(m1, m2 []int) bool {
return false
}
}
return true;
return true
}
func equalStrings(m1, m2 []string) bool {
l := len(m1);
l := len(m1)
if l != len(m2) {
return false
}
@ -150,11 +150,11 @@ func equalStrings(m1, m2 []string) bool {
return false
}
}
return true;
return true
}
func equalBytes(m1 [][]byte, m2 []string) bool {
l := len(m1);
l := len(m1)
if l != len(m2) {
return false
}
@ -163,28 +163,28 @@ func equalBytes(m1 [][]byte, m2 []string) bool {
return false
}
}
return true;
return true
}
func executeTest(t *T, expr string, str string, match []int) {
re := compileTest(t, expr, "");
re := compileTest(t, expr, "")
if re == nil {
return
}
m := re.ExecuteString(str);
m := re.ExecuteString(str)
if !equal(m, match) {
t.Error("ExecuteString failure on `", expr, "` matching `", str, "`:");
printVec(t, m);
t.Log("should be:");
printVec(t, match);
t.Error("ExecuteString failure on `", expr, "` matching `", str, "`:")
printVec(t, m)
t.Log("should be:")
printVec(t, match)
}
// now try bytes
m = re.Execute(strings.Bytes(str));
m = re.Execute(strings.Bytes(str))
if !equal(m, match) {
t.Error("Execute failure on `", expr, "` matching `", str, "`:");
printVec(t, m);
t.Log("should be:");
printVec(t, match);
t.Error("Execute failure on `", expr, "` matching `", str, "`:")
printVec(t, m)
t.Log("should be:")
printVec(t, match)
}
}
@ -202,22 +202,22 @@ func TestBadCompile(t *T) {
func TestExecute(t *T) {
for i := 0; i < len(matches); i++ {
test := &matches[i];
executeTest(t, test.re, test.text, test.match);
test := &matches[i]
executeTest(t, test.re, test.text, test.match)
}
}
func matchTest(t *T, expr string, str string, match []int) {
re := compileTest(t, expr, "");
re := compileTest(t, expr, "")
if re == nil {
return
}
m := re.MatchString(str);
m := re.MatchString(str)
if m != (len(match) > 0) {
t.Error("MatchString failure on `", expr, "` matching `", str, "`:", m, "should be", len(match) > 0)
}
// now try bytes
m = re.Match(strings.Bytes(str));
m = re.Match(strings.Bytes(str))
if m != (len(match) > 0) {
t.Error("Match failure on `", expr, "` matching `", str, "`:", m, "should be", len(match) > 0)
}
@ -225,46 +225,46 @@ func matchTest(t *T, expr string, str string, match []int) {
func TestMatch(t *T) {
for i := 0; i < len(matches); i++ {
test := &matches[i];
matchTest(t, test.re, test.text, test.match);
test := &matches[i]
matchTest(t, test.re, test.text, test.match)
}
}
func matchStringsTest(t *T, expr string, str string, match []int) {
re := compileTest(t, expr, "");
re := compileTest(t, expr, "")
if re == nil {
return
}
strs := make([]string, len(match)/2);
strs := make([]string, len(match)/2)
for i := 0; i < len(match); i++ {
strs[i/2] = str[match[i]:match[i+1]]
}
m := re.MatchStrings(str);
m := re.MatchStrings(str)
if !equalStrings(m, strs) {
t.Error("MatchStrings failure on `", expr, "` matching `", str, "`:");
printStrings(t, m);
t.Log("should be:");
printStrings(t, strs);
t.Error("MatchStrings failure on `", expr, "` matching `", str, "`:")
printStrings(t, m)
t.Log("should be:")
printStrings(t, strs)
}
// now try bytes
s := re.MatchSlices(strings.Bytes(str));
s := re.MatchSlices(strings.Bytes(str))
if !equalBytes(s, strs) {
t.Error("MatchSlices failure on `", expr, "` matching `", str, "`:");
printBytes(t, s);
t.Log("should be:");
printStrings(t, strs);
t.Error("MatchSlices failure on `", expr, "` matching `", str, "`:")
printBytes(t, s)
t.Log("should be:")
printStrings(t, strs)
}
}
func TestMatchStrings(t *T) {
for i := 0; i < len(matches); i++ {
test := &matches[i];
matchTest(t, test.re, test.text, test.match);
test := &matches[i]
matchTest(t, test.re, test.text, test.match)
}
}
func matchFunctionTest(t *T, expr string, str string, match []int) {
m, err := MatchString(expr, str);
m, err := MatchString(expr, str)
if err == "" {
return
}
@ -275,15 +275,15 @@ func matchFunctionTest(t *T, expr string, str string, match []int) {
func TestMatchFunction(t *T) {
for i := 0; i < len(matches); i++ {
test := &matches[i];
matchFunctionTest(t, test.re, test.text, test.match);
test := &matches[i]
matchFunctionTest(t, test.re, test.text, test.match)
}
}
func BenchmarkSimpleMatch(b *B) {
b.StopTimer();
re, _ := CompileRegexp("a");
b.StartTimer();
b.StopTimer()
re, _ := CompileRegexp("a")
b.StartTimer()
for i := 0; i < b.N; i++ {
re.MatchString("a")
@ -291,9 +291,9 @@ func BenchmarkSimpleMatch(b *B) {
}
func BenchmarkUngroupedMatch(b *B) {
b.StopTimer();
re, _ := CompileRegexp("[a-z]+ [0-9]+ [a-z]+");
b.StartTimer();
b.StopTimer()
re, _ := CompileRegexp("[a-z]+ [0-9]+ [a-z]+")
b.StartTimer()
for i := 0; i < b.N; i++ {
re.MatchString("word 123 other")
@ -301,9 +301,9 @@ func BenchmarkUngroupedMatch(b *B) {
}
func BenchmarkGroupedMatch(b *B) {
b.StopTimer();
re, _ := CompileRegexp("([a-z]+) ([0-9]+) ([a-z]+)");
b.StartTimer();
b.StopTimer()
re, _ := CompileRegexp("([a-z]+) ([0-9]+) ([a-z]+)")
b.StartTimer()
for i := 0; i < b.N; i++ {
re.MatchString("word 123 other")

190
src/pkg/testing/script/script.go
View file

@ -6,37 +6,37 @@
package script
import (
"fmt";
"os";
"rand";
"reflect";
"strings";
"fmt"
"os"
"rand"
"reflect"
"strings"
)
// An Event is an element in a partially ordered set that either sends a value
// to a channel or expects a value from a channel.
type Event struct {
name string;
occurred bool;
predecessors []*Event;
action action;
name string
occurred bool
predecessors []*Event
action action
}
type action interface {
// getSend returns nil if the action is not a send action.
getSend() sendAction;
getSend() sendAction
// getRecv returns nil if the action is not a receive action.
getRecv() recvAction;
getRecv() recvAction
// getChannel returns the channel that the action operates on.
getChannel() interface{};
getChannel() interface{}
}
type recvAction interface {
recvMatch(interface{}) bool;
recvMatch(interface{}) bool
}
type sendAction interface {
send();
send()
}
// isReady returns true if all the predecessors of an Event have occurred.
@ -47,87 +47,87 @@ func (e Event) isReady() bool {
}
}
return true;
return true
}
// A Recv action reads a value from a channel and uses reflect.DeepMatch to
// compare it with an expected value.
type Recv struct {
Channel interface{};
Expected interface{};
Channel interface{}
Expected interface{}
}
func (r Recv) getRecv() recvAction { return r }
func (r Recv) getRecv() recvAction { return r }
func (Recv) getSend() sendAction { return nil }
func (Recv) getSend() sendAction { return nil }
func (r Recv) getChannel() interface{} { return r.Channel }
func (r Recv) getChannel() interface{} { return r.Channel }
func (r Recv) recvMatch(chanEvent interface{}) bool {
c, ok := chanEvent.(channelRecv);
c, ok := chanEvent.(channelRecv)
if !ok || c.channel != r.Channel {
return false
}
return reflect.DeepEqual(c.value, r.Expected);
return reflect.DeepEqual(c.value, r.Expected)
}
// A RecvMatch action reads a value from a channel and calls a function to
// determine if the value matches.
type RecvMatch struct {
Channel interface{};
Match func(interface{}) bool;
Channel interface{}
Match func(interface{}) bool
}
func (r RecvMatch) getRecv() recvAction { return r }
func (r RecvMatch) getRecv() recvAction { return r }
func (RecvMatch) getSend() sendAction { return nil }
func (RecvMatch) getSend() sendAction { return nil }
func (r RecvMatch) getChannel() interface{} { return r.Channel }
func (r RecvMatch) getChannel() interface{} { return r.Channel }
func (r RecvMatch) recvMatch(chanEvent interface{}) bool {
c, ok := chanEvent.(channelRecv);
c, ok := chanEvent.(channelRecv)
if !ok || c.channel != r.Channel {
return false
}
return r.Match(c.value);
return r.Match(c.value)
}
// A Closed action matches if the given channel is closed. The closing is
// treated as an event, not a state, thus Closed will only match once for a
// given channel.
type Closed struct {
Channel interface{};
Channel interface{}
}
func (r Closed) getRecv() recvAction { return r }
func (r Closed) getRecv() recvAction { return r }
func (Closed) getSend() sendAction { return nil }
func (Closed) getSend() sendAction { return nil }
func (r Closed) getChannel() interface{} { return r.Channel }
func (r Closed) getChannel() interface{} { return r.Channel }
func (r Closed) recvMatch(chanEvent interface{}) bool {
c, ok := chanEvent.(channelClosed);
c, ok := chanEvent.(channelClosed)
if !ok || c.channel != r.Channel {
return false
}
return true;
return true
}
// A Send action sends a value to a channel. The value must match the
// type of the channel exactly unless the channel if of type chan interface{}.
type Send struct {
Channel interface{};
Value interface{};
Channel interface{}
Value interface{}
}
func (Send) getRecv() recvAction { return nil }
func (Send) getRecv() recvAction { return nil }
func (s Send) getSend() sendAction { return s }
func (s Send) getSend() sendAction { return s }
func (s Send) getChannel() interface{} { return s.Channel }
func (s Send) getChannel() interface{} { return s.Channel }
func newEmptyInterface(args ...) reflect.Value {
return reflect.NewValue(args).(*reflect.StructValue).Field(0)
@ -137,53 +137,53 @@ func (s Send) send() {
// With reflect.ChanValue.Send, we must match the types exactly. So, if
// s.Channel is a chan interface{} we convert s.Value to an interface{}
// first.
c := reflect.NewValue(s.Channel).(*reflect.ChanValue);
var v reflect.Value;
c := reflect.NewValue(s.Channel).(*reflect.ChanValue)
var v reflect.Value
if iface, ok := c.Type().(*reflect.ChanType).Elem().(*reflect.InterfaceType); ok && iface.NumMethod() == 0 {
v = newEmptyInterface(s.Value)
} else {
v = reflect.NewValue(s.Value)
}
c.Send(v);
c.Send(v)
}
// A Close action closes the given channel.
type Close struct {
Channel interface{};
Channel interface{}
}
func (Close) getRecv() recvAction { return nil }
func (Close) getRecv() recvAction { return nil }
func (s Close) getSend() sendAction { return s }
func (s Close) getSend() sendAction { return s }
func (s Close) getChannel() interface{} { return s.Channel }
func (s Close) getChannel() interface{} { return s.Channel }
func (s Close) send() { reflect.NewValue(s.Channel).(*reflect.ChanValue).Close() }
func (s Close) send() { reflect.NewValue(s.Channel).(*reflect.ChanValue).Close() }
// A ReceivedUnexpected error results if no active Events match a value
// received from a channel.
type ReceivedUnexpected struct {
Value interface{};
ready []*Event;
Value interface{}
ready []*Event
}
func (r ReceivedUnexpected) String() string {
names := make([]string, len(r.ready));
names := make([]string, len(r.ready))
for i, v := range r.ready {
names[i] = v.name
}
return fmt.Sprintf("received unexpected value on one of the channels: %#v. Runnable events: %s", r.Value, strings.Join(names, ", "));
return fmt.Sprintf("received unexpected value on one of the channels: %#v. Runnable events: %s", r.Value, strings.Join(names, ", "))
}
// A SetupError results if there is a error with the configuration of a set of
// Events.
type SetupError string
func (s SetupError) String() string { return string(s) }
func (s SetupError) String() string { return string(s) }
func NewEvent(name string, predecessors []*Event, action action) *Event {
e := &Event{name, false, predecessors, action};
return e;
e := &Event{name, false, predecessors, action}
return e
}
// Given a set of Events, Perform repeatedly iterates over the set and finds the
@ -220,20 +220,20 @@ func NewEvent(name string, predecessors []*Event, action action) *Event {
// thus Perform may see a value from a channel that is not in the current ready
// set and fail.
func Perform(seed int64, events []*Event) (err os.Error) {
r := rand.New(rand.NewSource(seed));
r := rand.New(rand.NewSource(seed))
channels, err := getChannels(events);
channels, err := getChannels(events)
if err != nil {
return
}
multiplex := make(chan interface{});
multiplex := make(chan interface{})
for _, channel := range channels {
go recvValues(multiplex, channel)
}
Outer:
for {
ready, err := readyEvents(events);
ready, err := readyEvents(events)
if err != nil {
return err
}
@ -243,113 +243,113 @@ Outer:
break
}
event := ready[r.Intn(len(ready))];
event := ready[r.Intn(len(ready))]
if send := event.action.getSend(); send != nil {
send.send();
event.occurred = true;
continue;
send.send()
event.occurred = true
continue
}
v := <-multiplex;
v := <-multiplex
for _, event := range ready {
if recv := event.action.getRecv(); recv != nil && recv.recvMatch(v) {
event.occurred = true;
continue Outer;
event.occurred = true
continue Outer
}
}
return ReceivedUnexpected{v, ready};
return ReceivedUnexpected{v, ready}
}
return nil;
return nil
}
// getChannels returns all the channels listed in any receive events.
func getChannels(events []*Event) ([]interface{}, os.Error) {
channels := make([]interface{}, len(events));
channels := make([]interface{}, len(events))
j := 0;
j := 0
for _, event := range events {
if recv := event.action.getRecv(); recv == nil {
continue
}
c := event.action.getChannel();
c := event.action.getChannel()
if _, ok := reflect.NewValue(c).(*reflect.ChanValue); !ok {
return nil, SetupError("one of the channel values is not a channel")
}
duplicate := false;
duplicate := false
for _, other := range channels[0:j] {
if c == other {
duplicate = true;
break;
duplicate = true
break
}
}
if !duplicate {
channels[j] = c;
j++;
channels[j] = c
j++
}
}
return channels[0:j], nil;
return channels[0:j], nil
}
// recvValues is a multiplexing helper function. It reads values from the given
// channel repeatedly, wrapping them up as either a channelRecv or
// channelClosed structure, and forwards them to the multiplex channel.
func recvValues(multiplex chan<- interface{}, channel interface{}) {
c := reflect.NewValue(channel).(*reflect.ChanValue);
c := reflect.NewValue(channel).(*reflect.ChanValue)
for {
v := c.Recv();
v := c.Recv()
if c.Closed() {
multiplex <- channelClosed{channel};
return;
multiplex <- channelClosed{channel}
return
}
multiplex <- channelRecv{channel, v.Interface()};
multiplex <- channelRecv{channel, v.Interface()}
}
}
type channelClosed struct {
channel interface{};
channel interface{}
}
type channelRecv struct {
channel interface{};
value interface{};
channel interface{}
value interface{}
}
// readyEvents returns the subset of events that are ready.
func readyEvents(events []*Event) ([]*Event, os.Error) {
ready := make([]*Event, len(events));
ready := make([]*Event, len(events))
j := 0;
eventsWaiting := false;
j := 0
eventsWaiting := false
for _, event := range events {
if event.occurred {
continue
}
eventsWaiting = true;
eventsWaiting = true
if event.isReady() {
ready[j] = event;
j++;
ready[j] = event
j++
}
}
if j == 0 && eventsWaiting {
names := make([]string, len(events));
names := make([]string, len(events))
for _, event := range events {
if event.occurred {
continue
}
names[j] = event.name;
names[j] = event.name
}
return nil, SetupError("dependency cycle in events. These events are waiting to run but cannot: " + strings.Join(names, ", "));
return nil, SetupError("dependency cycle in events. These events are waiting to run but cannot: " + strings.Join(names, ", "))
}
return ready[0:j], nil;
return ready[0:j], nil
}

42
src/pkg/testing/script/script_test.go
View file

@ -5,37 +5,37 @@
package script
import (
"testing";
"testing"
)
func TestNoop(t *testing.T) {
err := Perform(0, nil);
err := Perform(0, nil)
if err != nil {
t.Errorf("Got error: %s", err)
}
}
func TestSimple(t *testing.T) {
c := make(chan int);
defer close(c);
c := make(chan int)
defer close(c)
a := NewEvent("send", nil, Send{c, 1});
b := NewEvent("recv", []*Event{a}, Recv{c, 1});
a := NewEvent("send", nil, Send{c, 1})
b := NewEvent("recv", []*Event{a}, Recv{c, 1})
err := Perform(0, []*Event{a, b});
err := Perform(0, []*Event{a, b})
if err != nil {
t.Errorf("Got error: %s", err)
}
}
func TestFail(t *testing.T) {
c := make(chan int);
defer close(c);
c := make(chan int)
defer close(c)
a := NewEvent("send", nil, Send{c, 2});
b := NewEvent("recv", []*Event{a}, Recv{c, 1});
a := NewEvent("send", nil, Send{c, 2})
b := NewEvent("recv", []*Event{a}, Recv{c, 1})
err := Perform(0, []*Event{a, b});
err := Perform(0, []*Event{a, b})
if err == nil {
t.Errorf("Failed to get expected error")
} else if _, ok := err.(ReceivedUnexpected); !ok {
@ -44,12 +44,12 @@ func TestFail(t *testing.T) {
}
func TestClose(t *testing.T) {
c := make(chan int);
c := make(chan int)
a := NewEvent("close", nil, Close{c});
b := NewEvent("closed", []*Event{a}, Closed{c});
a := NewEvent("close", nil, Close{c})
b := NewEvent("closed", []*Event{a}, Closed{c})
err := Perform(0, []*Event{a, b});
err := Perform(0, []*Event{a, b})
if err != nil {
t.Errorf("Got error: %s", err)
}
@ -59,16 +59,16 @@ func matchOne(v interface{}) bool {
if i, ok := v.(int); ok && i == 1 {
return true
}
return false;
return false
}
func TestRecvMatch(t *testing.T) {
c := make(chan int);
c := make(chan int)
a := NewEvent("send", nil, Send{c, 1});
b := NewEvent("recv", []*Event{a}, RecvMatch{c, matchOne});
a := NewEvent("send", nil, Send{c, 1})
b := NewEvent("recv", []*Event{a}, RecvMatch{c, matchOne})
err := Perform(0, []*Event{a, b});
err := Perform(0, []*Event{a, b})
if err != nil {
t.Errorf("Got error: %s", err)
}

94
src/pkg/testing/testing.go
View file

@ -39,10 +39,10 @@
package testing
import (
"flag";
"fmt";
"os";
"runtime";
"flag"
"fmt"
"os"
"runtime"
)
// Report as tests are run; default is silent for success.
@ -52,44 +52,44 @@ var match = flag.String("match", "", "regular expression to select tests to run"
// Insert final newline if needed and tabs after internal newlines.
func tabify(s string) string {
n := len(s);
n := len(s)
if n > 0 && s[n-1] != '\n' {
s += "\n";
n++;
s += "\n"
n++
}
for i := 0; i < n-1; i++ { // -1 to avoid final newline
for i := 0; i < n-1; i++ { // -1 to avoid final newline
if s[i] == '\n' {
return s[0:i+1] + "\t" + tabify(s[i+1:n])
}
}
return s;
return s
}
// T is a type passed to Test functions to manage test state and support formatted test logs.
// Logs are accumulated during execution and dumped to standard error when done.
type T struct {
errors string;
failed bool;
ch chan *T;
errors string
failed bool
ch chan *T
}
// Fail marks the Test function as having failed but continues execution.
func (t *T) Fail() { t.failed = true }
func (t *T) Fail() { t.failed = true }
// Failed returns whether the Test function has failed.
func (t *T) Failed() bool { return t.failed }
func (t *T) Failed() bool { return t.failed }
// FailNow marks the Test function as having failed and stops its execution.
// Execution will continue at the next Test.
func (t *T) FailNow() {
t.Fail();
t.ch <- t;
runtime.Goexit();
t.Fail()
t.ch <- t
runtime.Goexit()
}
// Log formats its arguments using default formatting, analogous to Print(),
// and records the text in the error log.
func (t *T) Log(args ...) { t.errors += "\t" + tabify(fmt.Sprintln(args)) }
func (t *T) Log(args ...) { t.errors += "\t" + tabify(fmt.Sprintln(args)) }
// Log formats its arguments according to the format, analogous to Printf(),
// and records the text in the error log.
@ -99,52 +99,52 @@ func (t *T) Logf(format string, args ...) {
// Error is equivalent to Log() followed by Fail().
func (t *T) Error(args ...) {
t.Log(args);
t.Fail();
t.Log(args)
t.Fail()
}
// Errorf is equivalent to Logf() followed by Fail().
func (t *T) Errorf(format string, args ...) {
t.Logf(format, args);
t.Fail();
t.Logf(format, args)
t.Fail()
}
// Fatal is equivalent to Log() followed by FailNow().
func (t *T) Fatal(args ...) {
t.Log(args);
t.FailNow();
t.Log(args)
t.FailNow()
}
// Fatalf is equivalent to Logf() followed by FailNow().
func (t *T) Fatalf(format string, args ...) {
t.Logf(format, args);
t.FailNow();
t.Logf(format, args)
t.FailNow()
}
// An internal type but exported because it is cross-package; part of the implementation
// of gotest.
type Test struct {
Name string;
F func(*T);
Name string
F func(*T)
}
func tRunner(t *T, test *Test) {
test.F(t);
t.ch <- t;
test.F(t)
t.ch <- t
}
// An internal function but exported because it is cross-package; part of the implementation
// of gotest.
func Main(tests []Test) {
flag.Parse();
ok := true;
flag.Parse()
ok := true
if len(tests) == 0 {
println("testing: warning: no tests to run")
}
re, err := CompileRegexp(*match);
re, err := CompileRegexp(*match)
if err != "" {
println("invalid regexp for -match:", err);
os.Exit(1);
println("invalid regexp for -match:", err)
os.Exit(1)
}
for i := 0; i < len(tests); i++ {
if !re.MatchString(tests[i].Name) {
@ -153,22 +153,22 @@ func Main(tests []Test) {
if *chatty {
println("=== RUN ", tests[i].Name)
}
t := new(T);
t.ch = make(chan *T);
go tRunner(t, &tests[i]);
<-t.ch;
t := new(T)
t.ch = make(chan *T)
go tRunner(t, &tests[i])
<-t.ch
if t.failed {
println("--- FAIL:", tests[i].Name);
print(t.errors);
ok = false;
println("--- FAIL:", tests[i].Name)
print(t.errors)
ok = false
} else if *chatty {
println("--- PASS:", tests[i].Name);
print(t.errors);
println("--- PASS:", tests[i].Name)
print(t.errors)
}
}
if !ok {
println("FAIL");
os.Exit(1);
println("FAIL")
os.Exit(1)
}
println("PASS");
println("PASS")
}

6
src/pkg/time/sleep.go
View file

@ -5,10 +5,10 @@
package time
import (
"os";
"syscall";
"os"
"syscall"
)
// Sleep pauses the current goroutine for ns nanoseconds.
// It returns os.EINTR if interrupted.
func Sleep(ns int64) os.Error { return os.NewSyscallError("sleep", syscall.Sleep(ns)) }
func Sleep(ns int64) os.Error { return os.NewSyscallError("sleep", syscall.Sleep(ns)) }

30
src/pkg/time/tick.go
View file

@ -23,19 +23,19 @@ package time
// A Ticker holds a synchronous channel that delivers `ticks' of a clock
// at intervals.
type Ticker struct {
C <-chan int64; // The channel on which the ticks are delivered.
ns int64;
shutdown bool;
C <-chan int64 // The channel on which the ticks are delivered.
ns int64
shutdown bool
}
// Stop turns off a ticker. After Stop, no more ticks will be delivered.
func (t *Ticker) Stop() { t.shutdown = true }
func (t *Ticker) Stop() { t.shutdown = true }
func (t *Ticker) ticker(c chan<- int64) {
now := Nanoseconds();
when := now;
now := Nanoseconds()
when := now
for !t.shutdown {
when += t.ns; // next alarm
when += t.ns // next alarm
// if c <- now took too long, skip ahead
if when < now {
@ -47,12 +47,12 @@ func (t *Ticker) ticker(c chan<- int64) {
when += t.ns
}
Sleep(when - now);
now = Nanoseconds();
Sleep(when - now)
now = Nanoseconds()
if t.shutdown {
return
}
c <- now;
c <- now
}
}
@ -62,7 +62,7 @@ func Tick(ns int64) <-chan int64 {
if ns <= 0 {
return nil
}
return NewTicker(ns).C;
return NewTicker(ns).C
}
// Ticker returns a new Ticker containing a synchronous channel that will
@ -72,8 +72,8 @@ func NewTicker(ns int64) *Ticker {
if ns <= 0 {
return nil
}
c := make(chan int64);
t := &Ticker{c, ns, false};
go t.ticker(c);
return t;
c := make(chan int64)
t := &Ticker{c, ns, false}
go t.ticker(c)
return t
}

26
src/pkg/time/tick_test.go
View file

@ -5,31 +5,31 @@
package time_test
import (
"testing";
. "time";
"testing"
. "time"
)
func TestTicker(t *testing.T) {
const (
Delta = 100 * 1e6;
Count = 10;
Delta = 100 * 1e6
Count = 10
)
ticker := NewTicker(Delta);
t0 := Nanoseconds();
ticker := NewTicker(Delta)
t0 := Nanoseconds()
for i := 0; i < Count; i++ {
<-ticker.C
}
ticker.Stop();
t1 := Nanoseconds();
ns := t1 - t0;
target := int64(Delta * Count);
slop := target * 2 / 10;
ticker.Stop()
t1 := Nanoseconds()
ns := t1 - t0
target := int64(Delta * Count)
slop := target * 2 / 10
if ns < target-slop || ns > target+slop {
t.Fatalf("%d ticks of %g ns took %g ns, expected %g", Count, float64(Delta), float64(ns), float64(target))
}
// Now test that the ticker stopped
Sleep(2 * Delta);
_, received := <-ticker.C;
Sleep(2 * Delta)
_, received := <-ticker.C
if received {
t.Fatalf("Ticker did not shut down")
}

272
src/pkg/time/time.go
View file

@ -7,48 +7,48 @@
package time
import (
"os";
"os"
)
// Seconds reports the number of seconds since the Unix epoch,
// January 1, 1970 00:00:00 UTC.
func Seconds() int64 {
sec, _, err := os.Time();
sec, _, err := os.Time()
if err != nil {
panic("time: os.Time: ", err.String())
}
return sec;
return sec
}
// Nanoseconds reports the number of nanoseconds since the Unix epoch,
// January 1, 1970 00:00:00 UTC.
func Nanoseconds() int64 {
sec, nsec, err := os.Time();
sec, nsec, err := os.Time()
if err != nil {
panic("time: os.Time: ", err.String())
}
return sec*1e9 + nsec;
return sec*1e9 + nsec
}
// Days of the week.
const (
Sunday = iota;
Monday;
Tuesday;
Wednesday;
Thursday;
Friday;
Saturday;
Sunday = iota
Monday
Tuesday
Wednesday
Thursday
Friday
Saturday
)
// Time is the struct representing a parsed time value.
type Time struct {
Year int64; // 2008 is 2008
Month, Day int; // Sep-17 is 9, 17
Hour, Minute, Second int; // 10:43:12 is 10, 43, 12
Weekday int; // Sunday, Monday, ...
ZoneOffset int; // seconds east of UTC
Zone string;
Year int64 // 2008 is 2008
Month, Day int // Sep-17 is 9, 17
Hour, Minute, Second int // 10:43:12 is 10, 43, 12
Weekday int // Sunday, Monday, ...
ZoneOffset int // seconds east of UTC
Zone string
}
var nonleapyear = []int{31, 28, 31, 30, 31, 30, 31, 31, 30, 31, 30, 31}
@ -58,37 +58,37 @@ func months(year int64) []int {
if year%4 == 0 && (year%100 != 0 || year%400 == 0) {
return leapyear
}
return nonleapyear;
return nonleapyear
}
const (
secondsPerDay = 24 * 60 * 60;
daysPer400Years = 365*400 + 97;
daysPer100Years = 365*100 + 24;
daysPer4Years = 365*4 + 1;
days1970To2001 = 31*365 + 8;
secondsPerDay = 24 * 60 * 60
daysPer400Years = 365*400 + 97
daysPer100Years = 365*100 + 24
daysPer4Years = 365*4 + 1
days1970To2001 = 31*365 + 8
)
// SecondsToUTC converts sec, in number of seconds since the Unix epoch,
// into a parsed Time value in the UTC time zone.
func SecondsToUTC(sec int64) *Time {
t := new(Time);
t := new(Time)
// Split into time and day.
day := sec / secondsPerDay;
sec -= day * secondsPerDay;
day := sec / secondsPerDay
sec -= day * secondsPerDay
if sec < 0 {
day--;
sec += secondsPerDay;
day--
sec += secondsPerDay
}
// Time
t.Hour = int(sec / 3600);
t.Minute = int((sec / 60) % 60);
t.Second = int(sec % 60);
t.Hour = int(sec / 3600)
t.Minute = int((sec / 60) % 60)
t.Second = int(sec % 60)
// Day 0 = January 1, 1970 was a Thursday
t.Weekday = int((day + Thursday) % 7);
t.Weekday = int((day + Thursday) % 7)
if t.Weekday < 0 {
t.Weekday += 7
}
@ -96,78 +96,78 @@ func SecondsToUTC(sec int64) *Time {
// Change day from 0 = 1970 to 0 = 2001,
// to make leap year calculations easier
// (2001 begins 4-, 100-, and 400-year cycles ending in a leap year.)
day -= days1970To2001;
day -= days1970To2001
year := int64(2001);
year := int64(2001)
if day < 0 {
// Go back enough 400 year cycles to make day positive.
n := -day/daysPer400Years + 1;
year -= 400 * n;
day += daysPer400Years * n;
n := -day/daysPer400Years + 1
year -= 400 * n
day += daysPer400Years * n
}
// Cut off 400 year cycles.
n := day / daysPer400Years;
year += 400 * n;
day -= daysPer400Years * n;
n := day / daysPer400Years
year += 400 * n
day -= daysPer400Years * n
// Cut off 100-year cycles
n = day / daysPer100Years;
if n > 3 { // happens on last day of 400th year
n = day / daysPer100Years
if n > 3 { // happens on last day of 400th year
n = 3
}
year += 100 * n;
day -= daysPer100Years * n;
year += 100 * n
day -= daysPer100Years * n
// Cut off 4-year cycles
n = day / daysPer4Years;
if n > 24 { // happens on last day of 100th year
n = day / daysPer4Years
if n > 24 { // happens on last day of 100th year
n = 24
}
year += 4 * n;
day -= daysPer4Years * n;
year += 4 * n
day -= daysPer4Years * n
// Cut off non-leap years.
n = day / 365;
if n > 3 { // happens on last day of 4th year
n = day / 365
if n > 3 { // happens on last day of 4th year
n = 3
}
year += n;
day -= 365 * n;
year += n
day -= 365 * n
t.Year = year;
t.Year = year
// If someone ever needs yearday,
// tyearday = day (+1?)
months := months(year);
var m int;
yday := int(day);
months := months(year)
var m int
yday := int(day)
for m = 0; m < 12 && yday >= months[m]; m++ {
yday -= months[m]
}
t.Month = m + 1;
t.Day = yday + 1;
t.Zone = "UTC";
t.Month = m + 1
t.Day = yday + 1
t.Zone = "UTC"
return t;
return t
}
// UTC returns the current time as a parsed Time value in the UTC time zone.
func UTC() *Time { return SecondsToUTC(Seconds()) }
func UTC() *Time { return SecondsToUTC(Seconds()) }
// SecondsToLocalTime converts sec, in number of seconds since the Unix epoch,
// into a parsed Time value in the local time zone.
func SecondsToLocalTime(sec int64) *Time {
z, offset := lookupTimezone(sec);
t := SecondsToUTC(sec + int64(offset));
t.Zone = z;
t.ZoneOffset = offset;
return t;
z, offset := lookupTimezone(sec)
t := SecondsToUTC(sec + int64(offset))
t.Zone = z
t.ZoneOffset = offset
return t
}
// LocalTime returns the current time as a parsed Time value in the local time zone.
func LocalTime() *Time { return SecondsToLocalTime(Seconds()) }
func LocalTime() *Time { return SecondsToLocalTime(Seconds()) }
// Seconds returns the number of seconds since January 1, 1970 represented by the
// parsed Time value.
@ -176,56 +176,56 @@ func (t *Time) Seconds() int64 {
// Using 2001 instead of 1970 makes the leap-year
// handling easier (see SecondsToUTC), because
// it is at the beginning of the 4-, 100-, and 400-year cycles.
day := int64(0);
day := int64(0)
// Rewrite year to be >= 2001.
year := t.Year;
year := t.Year
if year < 2001 {
n := (2001-year)/400 + 1;
year += 400 * n;
day -= daysPer400Years * n;
n := (2001-year)/400 + 1
year += 400 * n
day -= daysPer400Years * n
}
// Add in days from 400-year cycles.
n := (year - 2001) / 400;
year -= 400 * n;
day += daysPer400Years * n;
n := (year - 2001) / 400
year -= 400 * n
day += daysPer400Years * n
// Add in 100-year cycles.
n = (year - 2001) / 100;
year -= 100 * n;
day += daysPer100Years * n;
n = (year - 2001) / 100
year -= 100 * n
day += daysPer100Years * n
// Add in 4-year cycles.
n = (year - 2001) / 4;
year -= 4 * n;
day += daysPer4Years * n;
n = (year - 2001) / 4
year -= 4 * n
day += daysPer4Years * n
// Add in non-leap years.
n = year - 2001;
day += 365 * n;
n = year - 2001
day += 365 * n
// Add in days this year.
months := months(t.Year);
months := months(t.Year)
for m := 0; m < t.Month-1; m++ {
day += int64(months[m])
}
day += int64(t.Day - 1);
day += int64(t.Day - 1)
// Convert days to seconds since January 1, 2001.
sec := day * secondsPerDay;
sec := day * secondsPerDay
// Add in time elapsed today.
sec += int64(t.Hour) * 3600;
sec += int64(t.Minute) * 60;
sec += int64(t.Second);
sec += int64(t.Hour) * 3600
sec += int64(t.Minute) * 60
sec += int64(t.Second)
// Convert from seconds since 2001 to seconds since 1970.
sec += days1970To2001 * secondsPerDay;
sec += days1970To2001 * secondsPerDay
// Account for local time zone.
sec -= int64(t.ZoneOffset);
return sec;
sec -= int64(t.ZoneOffset)
return sec
}
var longDayNames = []string{
@ -275,86 +275,86 @@ func decimal(dst []byte, n int) {
n = 0
}
for i := len(dst) - 1; i >= 0; i-- {
dst[i] = byte(n%10 + '0');
n /= 10;
dst[i] = byte(n%10 + '0')
n /= 10
}
}
func addString(buf []byte, bp int, s string) int {
n := len(s);
copy(buf[bp:bp+n], s);
return bp + n;
n := len(s)
copy(buf[bp:bp+n], s)
return bp + n
}
// Just enough of strftime to implement the date formats below.
// Not exported.
func format(t *Time, fmt string) string {
buf := make([]byte, 128);
bp := 0;
buf := make([]byte, 128)
bp := 0
for i := 0; i < len(fmt); i++ {
if fmt[i] == '%' {
i++;
i++
switch fmt[i] {
case 'A': // %A full weekday name
case 'A': // %A full weekday name
bp = addString(buf, bp, longDayNames[t.Weekday])
case 'a': // %a abbreviated weekday name
case 'a': // %a abbreviated weekday name
bp = addString(buf, bp, shortDayNames[t.Weekday])
case 'b': // %b abbreviated month name
case 'b': // %b abbreviated month name
bp = addString(buf, bp, shortMonthNames[t.Month])
case 'd': // %d day of month (01-31)
decimal(buf[bp:bp+2], t.Day);
bp += 2;
case 'e': // %e day of month ( 1-31)
case 'd': // %d day of month (01-31)
decimal(buf[bp:bp+2], t.Day)
bp += 2
case 'e': // %e day of month ( 1-31)
if t.Day >= 10 {
decimal(buf[bp:bp+2], t.Day)
} else {
buf[bp] = ' ';
buf[bp+1] = byte(t.Day + '0');
buf[bp] = ' '
buf[bp+1] = byte(t.Day + '0')
}
bp += 2;
case 'H': // %H hour 00-23
decimal(buf[bp:bp+2], t.Hour);
bp += 2;
case 'M': // %M minute 00-59
decimal(buf[bp:bp+2], t.Minute);
bp += 2;
case 'S': // %S second 00-59
decimal(buf[bp:bp+2], t.Second);
bp += 2;
case 'Y': // %Y year 2008
decimal(buf[bp:bp+4], int(t.Year));
bp += 4;
case 'y': // %y year 08
decimal(buf[bp:bp+2], int(t.Year%100));
bp += 2;
bp += 2
case 'H': // %H hour 00-23
decimal(buf[bp:bp+2], t.Hour)
bp += 2
case 'M': // %M minute 00-59
decimal(buf[bp:bp+2], t.Minute)
bp += 2
case 'S': // %S second 00-59
decimal(buf[bp:bp+2], t.Second)
bp += 2
case 'Y': // %Y year 2008
decimal(buf[bp:bp+4], int(t.Year))
bp += 4
case 'y': // %y year 08
decimal(buf[bp:bp+2], int(t.Year%100))
bp += 2
case 'Z':
bp = addString(buf, bp, t.Zone)
default:
buf[bp] = '%';
buf[bp+1] = fmt[i];
bp += 2;
buf[bp] = '%'
buf[bp+1] = fmt[i]
bp += 2
}
} else {
buf[bp] = fmt[i];
bp++;
buf[bp] = fmt[i]
bp++
}
}
return string(buf[0:bp]);
return string(buf[0:bp])
}
// Asctime formats the parsed time value in the style of
// ANSI C asctime: Sun Nov 6 08:49:37 1994
func (t *Time) Asctime() string { return format(t, "%a %b %e %H:%M:%S %Y") }
func (t *Time) Asctime() string { return format(t, "%a %b %e %H:%M:%S %Y") }
// RFC850 formats the parsed time value in the style of
// RFC 850: Sunday, 06-Nov-94 08:49:37 UTC
func (t *Time) RFC850() string { return format(t, "%A, %d-%b-%y %H:%M:%S %Z") }
func (t *Time) RFC850() string { return format(t, "%A, %d-%b-%y %H:%M:%S %Z") }
// RFC1123 formats the parsed time value in the style of
// RFC 1123: Sun, 06 Nov 1994 08:49:37 UTC
func (t *Time) RFC1123() string { return format(t, "%a, %d %b %Y %H:%M:%S %Z") }
func (t *Time) RFC1123() string { return format(t, "%a, %d %b %Y %H:%M:%S %Z") }
// String formats the parsed time value in the style of
// date(1) - Sun Nov 6 08:49:37 UTC 1994
func (t *Time) String() string { return format(t, "%a %b %e %H:%M:%S %Z %Y") }
func (t *Time) String() string { return format(t, "%a %b %e %H:%M:%S %Z %Y") }

46
src/pkg/time/time_test.go
View file

@ -5,10 +5,10 @@
package time_test
import (
"os";
"testing";
"testing/quick";
. "time";
"os"
"testing"
"testing/quick"
. "time"
)
func init() {
@ -19,8 +19,8 @@ func init() {
}
type TimeTest struct {
seconds int64;
golden Time;
seconds int64
golden Time
}
var utctests = []TimeTest{
@ -55,42 +55,42 @@ func same(t, u *Time) bool {
func TestSecondsToUTC(t *testing.T) {
for i := 0; i < len(utctests); i++ {
sec := utctests[i].seconds;
golden := &utctests[i].golden;
tm := SecondsToUTC(sec);
newsec := tm.Seconds();
sec := utctests[i].seconds
golden := &utctests[i].golden
tm := SecondsToUTC(sec)
newsec := tm.Seconds()
if newsec != sec {
t.Errorf("SecondsToUTC(%d).Seconds() = %d", sec, newsec)
}
if !same(tm, golden) {
t.Errorf("SecondsToUTC(%d):", sec);
t.Errorf(" want=%+v", *golden);
t.Errorf(" have=%+v", *tm);
t.Errorf("SecondsToUTC(%d):", sec)
t.Errorf(" want=%+v", *golden)
t.Errorf(" have=%+v", *tm)
}
}
}
func TestSecondsToLocalTime(t *testing.T) {
for i := 0; i < len(localtests); i++ {
sec := localtests[i].seconds;
golden := &localtests[i].golden;
tm := SecondsToLocalTime(sec);
newsec := tm.Seconds();
sec := localtests[i].seconds
golden := &localtests[i].golden
tm := SecondsToLocalTime(sec)
newsec := tm.Seconds()
if newsec != sec {
t.Errorf("SecondsToLocalTime(%d).Seconds() = %d", sec, newsec)
}
if !same(tm, golden) {
t.Errorf("SecondsToLocalTime(%d):", sec);
t.Errorf(" want=%+v", *golden);
t.Errorf(" have=%+v", *tm);
t.Errorf("SecondsToLocalTime(%d):", sec)
t.Errorf(" want=%+v", *golden)
t.Errorf(" have=%+v", *tm)
}
}
}
func TestSecondsToUTCAndBack(t *testing.T) {
f := func(sec int64) bool { return SecondsToUTC(sec).Seconds() == sec };
f32 := func(sec int32) bool { return f(int64(sec)) };
cfg := &quick.Config{MaxCount: 10000};
f := func(sec int64) bool { return SecondsToUTC(sec).Seconds() == sec }
f32 := func(sec int32) bool { return f(int64(sec)) }
cfg := &quick.Config{MaxCount: 10000}
// Try a reasonable date first, then the huge ones.
if err := quick.Check(f32, cfg); err != nil {

136
src/pkg/time/zoneinfo.go
View file

@ -10,50 +10,50 @@
package time
import (
"io/ioutil";
"once";
"os";
"io/ioutil"
"once"
"os"
)
const (
headerSize = 4 + 16 + 4*7;
zoneDir = "/usr/share/zoneinfo/";
headerSize = 4 + 16 + 4*7
zoneDir = "/usr/share/zoneinfo/"
)
// Simple I/O interface to binary blob of data.
type data struct {
p []byte;
error bool;
p []byte
error bool
}
func (d *data) read(n int) []byte {
if len(d.p) < n {
d.p = nil;
d.error = true;
return nil;
d.p = nil
d.error = true
return nil
}
p := d.p[0:n];
d.p = d.p[n:];
return p;
p := d.p[0:n]
d.p = d.p[n:]
return p
}
func (d *data) big4() (n uint32, ok bool) {
p := d.read(4);
p := d.read(4)
if len(p) < 4 {
d.error = true;
return 0, false;
d.error = true
return 0, false
}
return uint32(p[0])<<24 | uint32(p[1])<<16 | uint32(p[2])<<8 | uint32(p[3]), true;
return uint32(p[0])<<24 | uint32(p[1])<<16 | uint32(p[2])<<8 | uint32(p[3]), true
}
func (d *data) byte() (n byte, ok bool) {
p := d.read(1);
p := d.read(1)
if len(p) < 1 {
d.error = true;
return 0, false;
d.error = true
return 0, false
}
return p[0], true;
return p[0], true
}
@ -64,24 +64,24 @@ func byteString(p []byte) string {
return string(p[0:i])
}
}
return string(p);
return string(p)
}
// Parsed representation
type zone struct {
utcoff int;
isdst bool;
name string;
utcoff int
isdst bool
name string
}
type zonetime struct {
time int32; // transition time, in seconds since 1970 GMT
zone *zone; // the zone that goes into effect at that time
isstd, isutc bool; // ignored - no idea what these mean
time int32 // transition time, in seconds since 1970 GMT
zone *zone // the zone that goes into effect at that time
isstd, isutc bool // ignored - no idea what these mean
}
func parseinfo(bytes []byte) (zt []zonetime, ok bool) {
d := data{bytes, false};
d := data{bytes, false}
// 4-byte magic "TZif"
if magic := d.read(4); string(magic) != "TZif" {
@ -89,7 +89,7 @@ func parseinfo(bytes []byte) (zt []zonetime, ok bool) {
}
// 1-byte version, then 15 bytes of padding
var p []byte;
var p []byte
if p = d.read(16); len(p) != 16 || p[0] != 0 && p[0] != '2' {
return nil, false
}
@ -102,46 +102,46 @@ func parseinfo(bytes []byte) (zt []zonetime, ok bool) {
// number of local time zones
// number of characters of time zone abbrev strings
const (
NUTCLocal = iota;
NStdWall;
NLeap;
NTime;
NZone;
NChar;
NUTCLocal = iota
NStdWall
NLeap
NTime
NZone
NChar
)
var n [6]int;
var n [6]int
for i := 0; i < 6; i++ {
nn, ok := d.big4();
nn, ok := d.big4()
if !ok {
return nil, false
}
n[i] = int(nn);
n[i] = int(nn)
}
// Transition times.
txtimes := data{d.read(n[NTime] * 4), false};
txtimes := data{d.read(n[NTime] * 4), false}
// Time zone indices for transition times.
txzones := d.read(n[NTime]);
txzones := d.read(n[NTime])
// Zone info structures
zonedata := data{d.read(n[NZone] * 6), false};
zonedata := data{d.read(n[NZone] * 6), false}
// Time zone abbreviations.
abbrev := d.read(n[NChar]);
abbrev := d.read(n[NChar])
// Leap-second time pairs
d.read(n[NLeap] * 8);
d.read(n[NLeap] * 8)
// Whether tx times associated with local time types
// are specified as standard time or wall time.
isstd := d.read(n[NStdWall]);
isstd := d.read(n[NStdWall])
// Whether tx times associated with local time types
// are specified as UTC or local time.
isutc := d.read(n[NUTCLocal]);
isutc := d.read(n[NUTCLocal])
if d.error { // ran out of data
if d.error { // ran out of data
return nil, false
}
@ -152,38 +152,38 @@ func parseinfo(bytes []byte) (zt []zonetime, ok bool) {
// Now we can build up a useful data structure.
// First the zone information.
// utcoff[4] isdst[1] nameindex[1]
z := make([]zone, n[NZone]);
z := make([]zone, n[NZone])
for i := 0; i < len(z); i++ {
var ok bool;
var n uint32;
var ok bool
var n uint32
if n, ok = zonedata.big4(); !ok {
return nil, false
}
z[i].utcoff = int(n);
var b byte;
z[i].utcoff = int(n)
var b byte
if b, ok = zonedata.byte(); !ok {
return nil, false
}
z[i].isdst = b != 0;
z[i].isdst = b != 0
if b, ok = zonedata.byte(); !ok || int(b) >= len(abbrev) {
return nil, false
}
z[i].name = byteString(abbrev[b:]);
z[i].name = byteString(abbrev[b:])
}
// Now the transition time info.
zt = make([]zonetime, n[NTime]);
zt = make([]zonetime, n[NTime])
for i := 0; i < len(zt); i++ {
var ok bool;
var n uint32;
var ok bool
var n uint32
if n, ok = txtimes.big4(); !ok {
return nil, false
}
zt[i].time = int32(n);
zt[i].time = int32(n)
if int(txzones[i]) >= len(z) {
return nil, false
}
zt[i].zone = &z[txzones[i]];
zt[i].zone = &z[txzones[i]]
if i < len(isstd) {
zt[i].isstd = isstd[i] != 0
}
@ -191,15 +191,15 @@ func parseinfo(bytes []byte) (zt []zonetime, ok bool) {
zt[i].isutc = isutc[i] != 0
}
}
return zt, true;
return zt, true
}
func readinfofile(name string) ([]zonetime, bool) {
buf, err := ioutil.ReadFile(name);
buf, err := ioutil.ReadFile(name)
if err != nil {
return nil, false
}
return parseinfo(buf);
return parseinfo(buf)
}
var zones []zonetime
@ -210,7 +210,7 @@ func setupZone() {
// $TZ="" means use UTC.
// $TZ="foo" means use /usr/share/zoneinfo/foo.
tz, err := os.Getenverror("TZ");
tz, err := os.Getenverror("TZ")
switch {
case err == os.ENOENV:
zones, _ = readinfofile("/etc/localtime")
@ -222,21 +222,21 @@ func setupZone() {
}
func lookupTimezone(sec int64) (zone string, offset int) {
once.Do(setupZone);
once.Do(setupZone)
if len(zones) == 0 {
return "UTC", 0
}
// Binary search for entry with largest time <= sec
tz := zones;
tz := zones
for len(tz) > 1 {
m := len(tz) / 2;
m := len(tz) / 2
if sec < int64(tz[m].time) {
tz = tz[0:m]
} else {
tz = tz[m:]
}
}
z := tz[0].zone;
return z.name, z.utcoff;
z := tz[0].zone
return z.name, z.utcoff
}

4
src/pkg/unicode/digit.go
View file

@ -6,8 +6,8 @@ package unicode
// IsDigit reports whether the rune is a decimal digit.
func IsDigit(rune int) bool {
if rune < 0x100 { // quick ASCII (Latin-1, really) check
if rune < 0x100 { // quick ASCII (Latin-1, really) check
return '0' <= rune && rune <= '9'
}
return Is(Digit, rune);
return Is(Digit, rune)
}

4
src/pkg/unicode/digit_test.go
View file

@ -5,8 +5,8 @@
package unicode_test
import (
"testing";
. "unicode";
"testing"
. "unicode"
)
var testDigit = []int{

104
src/pkg/unicode/letter.go
View file

@ -6,17 +6,17 @@
package unicode
const (
MaxRune = 0x10FFFF; // Maximum valid Unicode code point.
ReplacementChar = 0xFFFD; // Represents invalid code points.
MaxRune = 0x10FFFF // Maximum valid Unicode code point.
ReplacementChar = 0xFFFD // Represents invalid code points.
)
// The representation of a range of Unicode code points. The range runs from Lo to Hi
// inclusive and has the specified stride.
type Range struct {
Lo int;
Hi int;
Stride int;
Lo int
Hi int
Stride int
}
// The representation of a range of Unicode code points for case conversion.
@ -29,26 +29,26 @@ type Range struct {
// {UpperLower, UpperLower, UpperLower}
// The constant UpperLower has an otherwise impossible delta value.
type CaseRange struct {
Lo int;
Hi int;
Delta d;
Lo int
Hi int
Delta d
}
// Indices into the Delta arrays inside CaseRanges for case mapping.
const (
UpperCase = iota;
LowerCase;
TitleCase;
MaxCase;
UpperCase = iota
LowerCase
TitleCase
MaxCase
)
type d [MaxCase]int32 // to make the CaseRanges text shorter
type d [MaxCase]int32 // to make the CaseRanges text shorter
// If the Delta field of a CaseRange is UpperLower or LowerUpper, it means
// this CaseRange represents a sequence of the form (say)
// Upper Lower Upper Lower.
const (
UpperLower = MaxRune + 1; // (Cannot be a valid delta.)
UpperLower = MaxRune + 1 // (Cannot be a valid delta.)
)
// Is tests whether rune is in the specified table of ranges.
@ -62,17 +62,17 @@ func Is(ranges []Range, rune int) bool {
if rune < r.Lo {
return false
}
return (rune-r.Lo)%r.Stride == 0;
return (rune-r.Lo)%r.Stride == 0
}
return false;
return false
}
// binary search over ranges
lo := 0;
hi := len(ranges);
lo := 0
hi := len(ranges)
for lo < hi {
m := lo + (hi-lo)/2;
r := ranges[m];
m := lo + (hi-lo)/2
r := ranges[m]
if r.Lo <= rune && rune <= r.Hi {
return (rune-r.Lo)%r.Stride == 0
}
@ -82,67 +82,67 @@ func Is(ranges []Range, rune int) bool {
lo = m + 1
}
}
return false;
return false
}
// IsUpper reports whether the rune is an upper case letter.
func IsUpper(rune int) bool {
if rune < 0x80 { // quick ASCII check
if rune < 0x80 { // quick ASCII check
return 'A' <= rune && rune <= 'Z'
}
return Is(Upper, rune);
return Is(Upper, rune)
}
// IsLower reports whether the rune is a lower case letter.
func IsLower(rune int) bool {
if rune < 0x80 { // quick ASCII check
if rune < 0x80 { // quick ASCII check
return 'a' <= rune && rune <= 'z'
}
return Is(Lower, rune);
return Is(Lower, rune)
}
// IsTitle reports whether the rune is a title case letter.
func IsTitle(rune int) bool {
if rune < 0x80 { // quick ASCII check
if rune < 0x80 { // quick ASCII check
return false
}
return Is(Title, rune);
return Is(Title, rune)
}
// IsLetter reports whether the rune is a letter.
func IsLetter(rune int) bool {
if rune < 0x80 { // quick ASCII check
rune &^= 'a' - 'A';
return 'A' <= rune && rune <= 'Z';
if rune < 0x80 { // quick ASCII check
rune &^= 'a' - 'A'
return 'A' <= rune && rune <= 'Z'
}
return Is(Letter, rune);
return Is(Letter, rune)
}
// IsSpace reports whether the rune is a white space character.
func IsSpace(rune int) bool {
if rune <= 0xFF { // quick Latin-1 check
if rune <= 0xFF { // quick Latin-1 check
switch rune {
case '\t', '\n', '\v', '\f', '\r', ' ', 0x85, 0xA0:
return true
}
return false;
return false
}
return Is(White_Space, rune);
return Is(White_Space, rune)
}
// To maps the rune to the specified case: UpperCase, LowerCase, or TitleCase
func To(_case int, rune int) int {
if _case < 0 || MaxCase <= _case {
return ReplacementChar // as reasonable an error as any
return ReplacementChar // as reasonable an error as any
}
// binary search over ranges
lo := 0;
hi := len(CaseRanges);
lo := 0
hi := len(CaseRanges)
for lo < hi {
m := lo + (hi-lo)/2;
r := CaseRanges[m];
m := lo + (hi-lo)/2
r := CaseRanges[m]
if r.Lo <= rune && rune <= r.Hi {
delta := int(r.Delta[_case]);
delta := int(r.Delta[_case])
if delta > MaxRune {
// In an Upper-Lower sequence, which always starts with
// an UpperCase letter, the real deltas always look like:
@ -156,7 +156,7 @@ func To(_case int, rune int) int {
// is odd so we take the low bit from _case.
return r.Lo + ((rune-r.Lo)&^1 | _case&1)
}
return rune + delta;
return rune + delta
}
if rune < r.Lo {
hi = m
@ -164,38 +164,38 @@ func To(_case int, rune int) int {
lo = m + 1
}
}
return rune;
return rune
}
// ToUpper maps the rune to upper case
func ToUpper(rune int) int {
if rune < 0x80 { // quick ASCII check
if rune < 0x80 { // quick ASCII check
if 'a' <= rune && rune <= 'z' {
rune -= 'a' - 'A'
}
return rune;
return rune
}
return To(UpperCase, rune);
return To(UpperCase, rune)
}
// ToLower maps the rune to lower case
func ToLower(rune int) int {
if rune < 0x80 { // quick ASCII check
if rune < 0x80 { // quick ASCII check
if 'A' <= rune && rune <= 'Z' {
rune += 'a' - 'A'
}
return rune;
return rune
}
return To(LowerCase, rune);
return To(LowerCase, rune)
}
// ToTitle maps the rune to title case
func ToTitle(rune int) int {
if rune < 0x80 { // quick ASCII check
if 'a' <= rune && rune <= 'z' { // title case is upper case for ASCII
if rune < 0x80 { // quick ASCII check
if 'a' <= rune && rune <= 'z' { // title case is upper case for ASCII
rune -= 'a' - 'A'
}
return rune;
return rune
}
return To(TitleCase, rune);
return To(TitleCase, rune)
}

16
src/pkg/unicode/letter_test.go
View file

@ -5,8 +5,8 @@
package unicode_test
import (
"testing";
. "unicode";
"testing"
. "unicode"
)
var upperTest = []int{
@ -107,7 +107,7 @@ var spaceTest = []int{
}
type caseT struct {
cas, in, out int;
cas, in, out int
}
var caseTest = []caseT{
@ -258,12 +258,12 @@ func caseString(c int) string {
case TitleCase:
return "TitleCase"
}
return "ErrorCase";
return "ErrorCase"
}
func TestTo(t *testing.T) {
for _, c := range caseTest {
r := To(c.cas, c.in);
r := To(c.cas, c.in)
if c.out != r {
t.Errorf("To(U+%04X, %s) = U+%04X want U+%04X\n", c.in, caseString(c.cas), r, c.out)
}
@ -275,7 +275,7 @@ func TestToUpperCase(t *testing.T) {
if c.cas != UpperCase {
continue
}
r := ToUpper(c.in);
r := ToUpper(c.in)
if c.out != r {
t.Errorf("ToUpper(U+%04X) = U+%04X want U+%04X\n", c.in, r, c.out)
}
@ -287,7 +287,7 @@ func TestToLowerCase(t *testing.T) {
if c.cas != LowerCase {
continue
}
r := ToLower(c.in);
r := ToLower(c.in)
if c.out != r {
t.Errorf("ToLower(U+%04X) = U+%04X want U+%04X\n", c.in, r, c.out)
}
@ -299,7 +299,7 @@ func TestToTitleCase(t *testing.T) {
if c.cas != TitleCase {
continue
}
r := ToTitle(c.in);
r := ToTitle(c.in)
if c.out != r {
t.Errorf("ToTitle(U+%04X) = U+%04X want U+%04X\n", c.in, r, c.out)
}

454
src/pkg/unicode/maketables.go
View file

@ -8,26 +8,26 @@
package main
import (
"bufio";
"flag";
"fmt";
"http";
"log";
"os";
"sort";
"strconv";
"strings";
"regexp";
"unicode";
"bufio"
"flag"
"fmt"
"http"
"log"
"os"
"sort"
"strconv"
"strings"
"regexp"
"unicode"
)
func main() {
flag.Parse();
loadChars(); // always needed
printCategories();
printScriptOrProperty(false);
printScriptOrProperty(true);
printCases();
flag.Parse()
loadChars() // always needed
printCategories()
printScriptOrProperty(false)
printScriptOrProperty(true)
printCases()
}
var dataURL = flag.String("data", "", "full URL for UnicodeData.txt; defaults to --url/UnicodeData.txt")
@ -53,7 +53,7 @@ var test = flag.Bool("test",
var scriptRe = regexp.MustCompile(`([0-9A-F]+)(\.\.[0-9A-F]+)? *; ([A-Za-z_]+)`)
var die = log.New(os.Stderr, nil, "", log.Lexit|log.Lshortfile)
var category = map[string]bool{"letter": true} // Nd Lu etc. letter is a special case
var category = map[string]bool{"letter": true} // Nd Lu etc. letter is a special case
// UnicodeData.txt has form:
// 0037;DIGIT SEVEN;Nd;0;EN;;7;7;7;N;;;;;
@ -61,24 +61,24 @@ var category = map[string]bool{"letter": true} // Nd Lu etc. letter is a special
// See http://www.unicode.org/Public/5.1.0/ucd/UCD.html for full explanation
// The fields:
const (
FCodePoint = iota;
FName;
FGeneralCategory;
FCanonicalCombiningClass;
FBidiClass;
FDecompositionType;
FDecompositionMapping;
FNumericType;
FNumericValue;
FBidiMirrored;
FUnicode1Name;
FISOComment;
FSimpleUppercaseMapping;
FSimpleLowercaseMapping;
FSimpleTitlecaseMapping;
NumField;
FCodePoint = iota
FName
FGeneralCategory
FCanonicalCombiningClass
FBidiClass
FDecompositionType
FDecompositionMapping
FNumericType
FNumericValue
FBidiMirrored
FUnicode1Name
FISOComment
FSimpleUppercaseMapping
FSimpleLowercaseMapping
FSimpleTitlecaseMapping
NumField
MaxChar = 0x10FFFF; // anything above this shouldn't exist
MaxChar = 0x10FFFF // anything above this shouldn't exist
)
var fieldName = []string{
@ -101,12 +101,12 @@ var fieldName = []string{
// This contains only the properties we're interested in.
type Char struct {
field []string; // debugging only; could be deleted if we take out char.dump()
codePoint uint32; // if zero, this index is not a valid code point.
category string;
upperCase int;
lowerCase int;
titleCase int;
field []string // debugging only; could be deleted if we take out char.dump()
codePoint uint32 // if zero, this index is not a valid code point.
category string
upperCase int
lowerCase int
titleCase int
}
// Scripts.txt has form:
@ -115,13 +115,13 @@ type Char struct {
// See http://www.unicode.org/Public/5.1.0/ucd/UCD.html for full explanation
type Script struct {
lo, hi uint32; // range of code points
script string;
lo, hi uint32 // range of code points
script string
}
var chars = make([]Char, MaxChar+1)
var scripts = make(map[string][]Script)
var props = make(map[string][]Script) // a property looks like a script; can share the format
var props = make(map[string][]Script) // a property looks like a script; can share the format
var lastChar uint32 = 0
@ -132,40 +132,40 @@ var lastChar uint32 = 0
type State int
const (
SNormal State = iota; // known to be zero for the type
SFirst;
SLast;
SMissing;
SNormal State = iota // known to be zero for the type
SFirst
SLast
SMissing
)
func parseCategory(line string) (state State) {
field := strings.Split(line, ";", -1);
field := strings.Split(line, ";", -1)
if len(field) != NumField {
die.Logf("%5s: %d fields (expected %d)\n", line, len(field), NumField)
}
point, err := strconv.Btoui64(field[FCodePoint], 16);
point, err := strconv.Btoui64(field[FCodePoint], 16)
if err != nil {
die.Log("%.5s...:", err)
}
lastChar = uint32(point);
lastChar = uint32(point)
if point == 0 {
return // not interesting and we use 0 as unset
return // not interesting and we use 0 as unset
}
if point > MaxChar {
return
}
char := &chars[point];
char.field = field;
char := &chars[point]
char.field = field
if char.codePoint != 0 {
die.Logf("point U+%04x reused\n")
}
char.codePoint = lastChar;
char.category = field[FGeneralCategory];
category[char.category] = true;
char.codePoint = lastChar
char.category = field[FGeneralCategory]
category[char.category] = true
switch char.category {
case "Nd":
// Decimal digit
_, err := strconv.Atoi(field[FNumericValue]);
_, err := strconv.Atoi(field[FNumericValue])
if err != nil {
die.Log("U+%04x: bad numeric field: %s", point, err)
}
@ -184,66 +184,66 @@ func parseCategory(line string) (state State) {
case strings.Index(field[FName], ", Last>") > 0:
state = SLast
}
return;
return
}
func (char *Char) dump(s string) {
fmt.Print(s, " ");
fmt.Print(s, " ")
for i := 0; i < len(char.field); i++ {
fmt.Printf("%s:%q ", fieldName[i], char.field[i])
}
fmt.Print("\n");
fmt.Print("\n")
}
func (char *Char) letter(u, l, t string) {
char.upperCase = char.letterValue(u, "U");
char.lowerCase = char.letterValue(l, "L");
char.titleCase = char.letterValue(t, "T");
char.upperCase = char.letterValue(u, "U")
char.lowerCase = char.letterValue(l, "L")
char.titleCase = char.letterValue(t, "T")
}
func (char *Char) letterValue(s string, cas string) int {
if s == "" {
return 0
}
v, err := strconv.Btoui64(s, 16);
v, err := strconv.Btoui64(s, 16)
if err != nil {
char.dump(cas);
die.Logf("U+%04x: bad letter(%s): %s", char.codePoint, s, err);
char.dump(cas)
die.Logf("U+%04x: bad letter(%s): %s", char.codePoint, s, err)
}
return int(v);
return int(v)
}
func allCategories() []string {
a := make([]string, len(category));
i := 0;
a := make([]string, len(category))
i := 0
for k := range category {
a[i] = k;
i++;
a[i] = k
i++
}
return a;
return a
}
func all(scripts map[string][]Script) []string {
a := make([]string, len(scripts));
i := 0;
a := make([]string, len(scripts))
i := 0
for k := range scripts {
a[i] = k;
i++;
a[i] = k
i++
}
return a;
return a
}
// Extract the version number from the URL
func version() string {
// Break on slashes and look for the first numeric field
fields := strings.Split(*url, "/", 0);
fields := strings.Split(*url, "/", 0)
for _, f := range fields {
if len(f) > 0 && '0' <= f[0] && f[0] <= '9' {
return f
}
}
die.Log("unknown version");
return "Unknown";
die.Log("unknown version")
return "Unknown"
}
func letterOp(code int) bool {
@ -251,29 +251,29 @@ func letterOp(code int) bool {
case "Lu", "Ll", "Lt", "Lm", "Lo":
return true
}
return false;
return false
}
func loadChars() {
if *dataURL == "" {
flag.Set("data", *url+"UnicodeData.txt")
}
resp, _, err := http.Get(*dataURL);
resp, _, err := http.Get(*dataURL)
if err != nil {
die.Log(err)
}
if resp.StatusCode != 200 {
die.Log("bad GET status for UnicodeData.txt", resp.Status)
}
input := bufio.NewReader(resp.Body);
var first uint32 = 0;
input := bufio.NewReader(resp.Body)
var first uint32 = 0
for {
line, err := input.ReadString('\n');
line, err := input.ReadString('\n')
if err != nil {
if err == os.EOF {
break
}
die.Log(err);
die.Log(err)
}
switch parseCategory(line[0 : len(line)-1]) {
case SNormal:
@ -284,19 +284,19 @@ func loadChars() {
if first != 0 {
die.Logf("bad state first at U+%04X", lastChar)
}
first = lastChar;
first = lastChar
case SLast:
if first == 0 {
die.Logf("bad state last at U+%04X", lastChar)
}
for i := first + 1; i <= lastChar; i++ {
chars[i] = chars[first];
chars[i].codePoint = i;
chars[i] = chars[first]
chars[i].codePoint = i
}
first = 0;
first = 0
}
}
resp.Body.Close();
resp.Body.Close()
}
func printCategories() {
@ -304,13 +304,13 @@ func printCategories() {
return
}
// Find out which categories to dump
list := strings.Split(*tablelist, ",", 0);
list := strings.Split(*tablelist, ",", 0)
if *tablelist == "all" {
list = allCategories()
}
if *test {
fullCategoryTest(list);
return;
fullCategoryTest(list)
return
}
fmt.Printf(
"// Generated by running\n"+
@ -318,22 +318,22 @@ func printCategories() {
"// DO NOT EDIT\n\n"+
"package unicode\n\n",
*tablelist,
*dataURL);
*dataURL)
fmt.Println("// Version is the Unicode edition from which the tables are derived.");
fmt.Printf("const Version = %q\n\n", version());
fmt.Println("// Version is the Unicode edition from which the tables are derived.")
fmt.Printf("const Version = %q\n\n", version())
if *tablelist == "all" {
fmt.Println("// Categories is the set of Unicode data tables.");
fmt.Println("var Categories = map[string] []Range {");
fmt.Println("// Categories is the set of Unicode data tables.")
fmt.Println("var Categories = map[string] []Range {")
for k, _ := range category {
fmt.Printf("\t%q: %s,\n", k, k)
}
fmt.Printf("}\n\n");
fmt.Printf("}\n\n")
}
decl := make(sort.StringArray, len(list));
ndecl := 0;
decl := make(sort.StringArray, len(list))
ndecl := 0
for _, name := range list {
if _, ok := category[name]; !ok {
die.Log("unknown category", name)
@ -342,7 +342,7 @@ func printCategories() {
// name to store the data. This stops godoc dumping all the tables but keeps them
// available to clients.
// Cases deserving special comments
varDecl := "";
varDecl := ""
switch name {
case "letter":
varDecl = "\tLetter = letter; // Letter is the set of Unicode letters.\n"
@ -360,24 +360,24 @@ func printCategories() {
"\t%s = _%s; // %s is the set of Unicode characters in category %s.\n",
name, name, name, name)
}
decl[ndecl] = varDecl;
ndecl++;
if name == "letter" { // special case
decl[ndecl] = varDecl
ndecl++
if name == "letter" { // special case
dumpRange(
"var letter = []Range {\n",
letterOp);
continue;
letterOp)
continue
}
dumpRange(
fmt.Sprintf("var _%s = []Range {\n", name),
func(code int) bool { return chars[code].category == name });
func(code int) bool { return chars[code].category == name })
}
decl.Sort();
fmt.Println("var (");
decl.Sort()
fmt.Println("var (")
for _, d := range decl {
fmt.Print(d)
}
fmt.Println(")\n");
fmt.Println(")\n")
}
type Op func(code int) bool
@ -385,8 +385,8 @@ type Op func(code int) bool
const format = "\tRange{0x%04x, 0x%04x, %d},\n"
func dumpRange(header string, inCategory Op) {
fmt.Print(header);
next := 0;
fmt.Print(header)
next := 0
// one Range for each iteration
for {
// look for start of range
@ -399,22 +399,22 @@ func dumpRange(header string, inCategory Op) {
}
// start of range
lo := next;
hi := next;
stride := 1;
lo := next
hi := next
stride := 1
// accept lo
next++;
next++
// look for another character to set the stride
for next < len(chars) && !inCategory(next) {
next++
}
if next >= len(chars) {
// no more characters
fmt.Printf(format, lo, hi, stride);
break;
fmt.Printf(format, lo, hi, stride)
break
}
// set stride
stride = next - lo;
stride = next - lo
// check for length of run. next points to first jump in stride
for i := next; i < len(chars); i++ {
if inCategory(i) == (((i - lo) % stride) == 0) {
@ -427,11 +427,11 @@ func dumpRange(header string, inCategory Op) {
break
}
}
fmt.Printf(format, lo, hi, stride);
fmt.Printf(format, lo, hi, stride)
// next range: start looking where this range ends
next = hi + 1;
next = hi + 1
}
fmt.Print("}\n\n");
fmt.Print("}\n\n")
}
func fullCategoryTest(list []string) {
@ -439,7 +439,7 @@ func fullCategoryTest(list []string) {
if _, ok := category[name]; !ok {
die.Log("unknown category", name)
}
r, ok := unicode.Categories[name];
r, ok := unicode.Categories[name]
if !ok {
die.Log("unknown table", name)
}
@ -456,8 +456,8 @@ func fullCategoryTest(list []string) {
func verifyRange(name string, inCategory Op, table []unicode.Range) {
for i := range chars {
web := inCategory(i);
pkg := unicode.Is(table, i);
web := inCategory(i)
pkg := unicode.Is(table, i)
if web != pkg {
fmt.Fprintf(os.Stderr, "%s: U+%04X: web=%t pkg=%t\n", name, i, web, pkg)
}
@ -465,61 +465,61 @@ func verifyRange(name string, inCategory Op, table []unicode.Range) {
}
func parseScript(line string, scripts map[string][]Script) {
comment := strings.Index(line, "#");
comment := strings.Index(line, "#")
if comment >= 0 {
line = line[0:comment]
}
line = strings.TrimSpace(line);
line = strings.TrimSpace(line)
if len(line) == 0 {
return
}
field := strings.Split(line, ";", -1);
field := strings.Split(line, ";", -1)
if len(field) != 2 {
die.Logf("%s: %d fields (expected 2)\n", line, len(field))
}
matches := scriptRe.MatchStrings(line);
matches := scriptRe.MatchStrings(line)
if len(matches) != 4 {
die.Logf("%s: %d matches (expected 3)\n", line, len(matches))
}
lo, err := strconv.Btoui64(matches[1], 16);
lo, err := strconv.Btoui64(matches[1], 16)
if err != nil {
die.Log("%.5s...:", err)
}
hi := lo;
if len(matches[2]) > 2 { // ignore leading ..
hi, err = strconv.Btoui64(matches[2][2:], 16);
hi := lo
if len(matches[2]) > 2 { // ignore leading ..
hi, err = strconv.Btoui64(matches[2][2:], 16)
if err != nil {
die.Log("%.5s...:", err)
}
}
name := matches[3];
s, ok := scripts[name];
name := matches[3]
s, ok := scripts[name]
if !ok || len(s) == cap(s) {
ns := make([]Script, len(s), len(s)+100);
ns := make([]Script, len(s), len(s)+100)
for i, sc := range s {
ns[i] = sc
}
s = ns;
s = ns
}
s = s[0 : len(s)+1];
s[len(s)-1] = Script{uint32(lo), uint32(hi), name};
scripts[name] = s;
s = s[0 : len(s)+1]
s[len(s)-1] = Script{uint32(lo), uint32(hi), name}
scripts[name] = s
}
// The script tables have a lot of adjacent elements. Fold them together.
func foldAdjacent(r []Script) []unicode.Range {
s := make([]unicode.Range, 0, len(r));
j := 0;
s := make([]unicode.Range, 0, len(r))
j := 0
for i := 0; i < len(r); i++ {
if j > 0 && int(r[i].lo) == s[j-1].Hi+1 {
s[j-1].Hi = int(r[i].hi)
} else {
s = s[0 : j+1];
s[j] = unicode.Range{int(r[i].lo), int(r[i].hi), 1};
j++;
s = s[0 : j+1]
s[j] = unicode.Range{int(r[i].lo), int(r[i].hi), 1}
j++
}
}
return s;
return s
}
func fullScriptTest(list []string, installed map[string][]unicode.Range, scripts map[string][]Script) {
@ -527,7 +527,7 @@ func fullScriptTest(list []string, installed map[string][]unicode.Range, scripts
if _, ok := scripts[name]; !ok {
die.Log("unknown script", name)
}
_, ok := installed[name];
_, ok := installed[name]
if !ok {
die.Log("unknown table", name)
}
@ -543,50 +543,50 @@ func fullScriptTest(list []string, installed map[string][]unicode.Range, scripts
// PropList.txt has the same format as Scripts.txt so we can share its parser.
func printScriptOrProperty(doProps bool) {
flag := "scripts";
flaglist := *scriptlist;
file := "Scripts.txt";
table := scripts;
installed := unicode.Scripts;
flag := "scripts"
flaglist := *scriptlist
file := "Scripts.txt"
table := scripts
installed := unicode.Scripts
if doProps {
flag = "props";
flaglist = *proplist;
file = "PropList.txt";
table = props;
installed = unicode.Properties;
flag = "props"
flaglist = *proplist
file = "PropList.txt"
table = props
installed = unicode.Properties
}
if flaglist == "" {
return
}
var err os.Error;
resp, _, err := http.Get(*url + file);
var err os.Error
resp, _, err := http.Get(*url + file)
if err != nil {
die.Log(err)
}
if resp.StatusCode != 200 {
die.Log("bad GET status for ", file, ":", resp.Status)
}
input := bufio.NewReader(resp.Body);
input := bufio.NewReader(resp.Body)
for {
line, err := input.ReadString('\n');
line, err := input.ReadString('\n')
if err != nil {
if err == os.EOF {
break
}
die.Log(err);
die.Log(err)
}
parseScript(line[0:len(line)-1], table);
parseScript(line[0:len(line)-1], table)
}
resp.Body.Close();
resp.Body.Close()
// Find out which scripts to dump
list := strings.Split(flaglist, ",", 0);
list := strings.Split(flaglist, ",", 0)
if flaglist == "all" {
list = all(table)
}
if *test {
fullScriptTest(list, installed, table);
return;
fullScriptTest(list, installed, table)
return
}
fmt.Printf(
@ -595,23 +595,23 @@ func printScriptOrProperty(doProps bool) {
"// DO NOT EDIT\n\n",
flag,
flaglist,
*url);
*url)
if flaglist == "all" {
if doProps {
fmt.Println("// Properties is the set of Unicode property tables.");
fmt.Println("var Properties = map[string] []Range {");
fmt.Println("// Properties is the set of Unicode property tables.")
fmt.Println("var Properties = map[string] []Range {")
} else {
fmt.Println("// Scripts is the set of Unicode script tables.");
fmt.Println("var Scripts = map[string] []Range {");
fmt.Println("// Scripts is the set of Unicode script tables.")
fmt.Println("var Scripts = map[string] []Range {")
}
for k, _ := range table {
fmt.Printf("\t%q: %s,\n", k, k)
}
fmt.Printf("}\n\n");
fmt.Printf("}\n\n")
}
decl := make(sort.StringArray, len(list));
ndecl := 0;
decl := make(sort.StringArray, len(list))
ndecl := 0
for _, name := range list {
if doProps {
decl[ndecl] = fmt.Sprintf(
@ -622,36 +622,36 @@ func printScriptOrProperty(doProps bool) {
"\t%s = _%s;\t// %s is the set of Unicode characters in script %s.\n",
name, name, name, name)
}
ndecl++;
fmt.Printf("var _%s = []Range {\n", name);
ranges := foldAdjacent(table[name]);
ndecl++
fmt.Printf("var _%s = []Range {\n", name)
ranges := foldAdjacent(table[name])
for _, s := range ranges {
fmt.Printf(format, s.Lo, s.Hi, s.Stride)
}
fmt.Printf("}\n\n");
fmt.Printf("}\n\n")
}
decl.Sort();
fmt.Println("var (");
decl.Sort()
fmt.Println("var (")
for _, d := range decl {
fmt.Print(d)
}
fmt.Println(")\n");
fmt.Println(")\n")
}
const (
CaseUpper = 1 << iota;
CaseLower;
CaseTitle;
CaseNone = 0; // must be zero
CaseMissing = -1; // character not present; not a valid case state
CaseUpper = 1 << iota
CaseLower
CaseTitle
CaseNone = 0 // must be zero
CaseMissing = -1 // character not present; not a valid case state
)
type caseState struct {
point int;
_case int;
deltaToUpper int;
deltaToLower int;
deltaToTitle int;
point int
_case int
deltaToUpper int
deltaToLower int
deltaToTitle int
}
// Is d a continuation of the state of c?
@ -660,9 +660,9 @@ func (c *caseState) adjacent(d *caseState) bool {
c, d = d, c
}
switch {
case d.point != c.point+1: // code points not adjacent (shouldn't happen)
case d.point != c.point+1: // code points not adjacent (shouldn't happen)
return false
case d._case != c._case: // different cases
case d._case != c._case: // different cases
return c.upperLowerAdjacent(d)
case c._case == CaseNone:
return false
@ -675,7 +675,7 @@ func (c *caseState) adjacent(d *caseState) bool {
case d.deltaToTitle != c.deltaToTitle:
return false
}
return true;
return true
}
// Is d the same as c, but opposite in upper/lower case? this would make it
@ -709,7 +709,7 @@ func (c *caseState) upperLowerAdjacent(d *caseState) bool {
case d.deltaToTitle != -1:
return false
}
return true;
return true
}
// Does this character start an UpperLower sequence?
@ -724,7 +724,7 @@ func (c *caseState) isUpperLower() bool {
case c.deltaToTitle != 0:
return false
}
return true;
return true
}
// Does this character start a LowerUpper sequence?
@ -739,16 +739,16 @@ func (c *caseState) isLowerUpper() bool {
case c.deltaToTitle != -1:
return false
}
return true;
return true
}
func getCaseState(i int) (c *caseState) {
c = &caseState{point: i, _case: CaseNone};
ch := &chars[i];
c = &caseState{point: i, _case: CaseNone}
ch := &chars[i]
switch int(ch.codePoint) {
case 0:
c._case = CaseMissing; // Will get NUL wrong but that doesn't matter
return;
c._case = CaseMissing // Will get NUL wrong but that doesn't matter
return
case ch.upperCase:
c._case = CaseUpper
case ch.lowerCase:
@ -765,7 +765,7 @@ func getCaseState(i int) (c *caseState) {
if ch.titleCase != 0 {
c.deltaToTitle = ch.titleCase - i
}
return;
return
}
func printCases() {
@ -773,8 +773,8 @@ func printCases() {
return
}
if *test {
fullCaseTest();
return;
fullCaseTest()
return
}
fmt.Printf(
"// Generated by running\n"+
@ -784,25 +784,25 @@ func printCases() {
"// non-self mappings.\n"+
"var CaseRanges = _CaseRanges\n"+
"var _CaseRanges = []CaseRange {\n",
*dataURL);
*dataURL)
var startState *caseState; // the start of a run; nil for not active
var prevState = &caseState{}; // the state of the previous character
var startState *caseState // the start of a run; nil for not active
var prevState = &caseState{} // the state of the previous character
for i := range chars {
state := getCaseState(i);
state := getCaseState(i)
if state.adjacent(prevState) {
prevState = state;
continue;
prevState = state
continue
}
// end of run (possibly)
printCaseRange(startState, prevState);
startState = nil;
printCaseRange(startState, prevState)
startState = nil
if state._case != CaseMissing && state._case != CaseNone {
startState = state
}
prevState = state;
prevState = state
}
fmt.Printf("}\n");
fmt.Printf("}\n")
}
func printCaseRange(lo, hi *caseState) {
@ -818,9 +818,9 @@ func printCaseRange(lo, hi *caseState) {
fmt.Printf("\tCaseRange{0x%04X, 0x%04X, d{UpperLower, UpperLower, UpperLower}},\n",
lo.point, hi.point)
case hi.point > lo.point && lo.isLowerUpper():
die.Log("LowerUpper sequence: should not happen: U+%04X. If it's real, need to fix To()", lo.point);
die.Log("LowerUpper sequence: should not happen: U+%04X. If it's real, need to fix To()", lo.point)
fmt.Printf("\tCaseRange{0x%04X, 0x%04X, d{LowerUpper, LowerUpper, LowerUpper}},\n",
lo.point, hi.point);
lo.point, hi.point)
default:
fmt.Printf("\tCaseRange{0x%04X, 0x%04X, d{%d, %d, %d}},\n",
lo.point, hi.point,
@ -833,23 +833,23 @@ func caseIt(rune, cased int) int {
if cased == 0 {
return rune
}
return cased;
return cased
}
func fullCaseTest() {
for i, c := range chars {
lower := unicode.ToLower(i);
want := caseIt(i, c.lowerCase);
lower := unicode.ToLower(i)
want := caseIt(i, c.lowerCase)
if lower != want {
fmt.Fprintf(os.Stderr, "lower U+%04X should be U+%04X is U+%04X\n", i, want, lower)
}
upper := unicode.ToUpper(i);
want = caseIt(i, c.upperCase);
upper := unicode.ToUpper(i)
want = caseIt(i, c.upperCase)
if upper != want {
fmt.Fprintf(os.Stderr, "upper U+%04X should be U+%04X is U+%04X\n", i, want, upper)
}
title := unicode.ToTitle(i);
want = caseIt(i, c.titleCase);
title := unicode.ToTitle(i)
want = caseIt(i, c.titleCase)
if title != want {
fmt.Fprintf(os.Stderr, "title U+%04X should be U+%04X is U+%04X\n", i, want, title)
}

22
src/pkg/unicode/script_test.go
View file

@ -5,13 +5,13 @@
package unicode_test
import (
"testing";
. "unicode";
"testing"
. "unicode"
)
type T struct {
rune int;
script string;
rune int
script string
}
// Hand-chosen tests from Unicode 5.1.0, mostly to discover when new
@ -112,7 +112,7 @@ var inTest = []T{
T{0xa216, "Yi"},
}
var outTest = []T{ // not really worth being thorough
var outTest = []T{ // not really worth being thorough
T{0x20, "Telugu"},
}
@ -185,7 +185,7 @@ var inPropTest = []T{
}
func TestScripts(t *testing.T) {
notTested := make(map[string]bool);
notTested := make(map[string]bool)
for k := range Scripts {
notTested[k] = true
}
@ -196,7 +196,7 @@ func TestScripts(t *testing.T) {
if !Is(Scripts[test.script], test.rune) {
t.Errorf("IsScript(%#x, %s) = false, want true\n", test.rune, test.script)
}
notTested[test.script] = false, false;
notTested[test.script] = false, false
}
for _, test := range outTest {
if Is(Scripts[test.script], test.rune) {
@ -209,7 +209,7 @@ func TestScripts(t *testing.T) {
}
func TestCategories(t *testing.T) {
notTested := make(map[string]bool);
notTested := make(map[string]bool)
for k := range Categories {
notTested[k] = true
}
@ -220,7 +220,7 @@ func TestCategories(t *testing.T) {
if !Is(Categories[test.script], test.rune) {
t.Errorf("IsCategory(%#x, %s) = false, want true\n", test.rune, test.script)
}
notTested[test.script] = false, false;
notTested[test.script] = false, false
}
for k := range notTested {
t.Error("not tested:", k)
@ -228,7 +228,7 @@ func TestCategories(t *testing.T) {
}
func TestProperties(t *testing.T) {
notTested := make(map[string]bool);
notTested := make(map[string]bool)
for k := range Properties {
notTested[k] = true
}
@ -239,7 +239,7 @@ func TestProperties(t *testing.T) {
if !Is(Properties[test.script], test.rune) {
t.Errorf("IsCategory(%#x, %s) = false, want true\n", test.rune, test.script)
}
notTested[test.script] = false, false;
notTested[test.script] = false, false
}
for k := range notTested {
t.Error("not tested:", k)

316
src/pkg/unicode/tables.go
View file

@ -1921,40 +1921,40 @@ var _Lo = []Range{
}
var (
Cc = _Cc; // Cc is the set of Unicode characters in category Cc.
Cf = _Cf; // Cf is the set of Unicode characters in category Cf.
Co = _Co; // Co is the set of Unicode characters in category Co.
Cs = _Cs; // Cs is the set of Unicode characters in category Cs.
Digit = _Nd; // Digit is the set of Unicode characters with the "decimal digit" property.
Nd = _Nd; // Nd is the set of Unicode characters in category Nd.
Letter = letter; // Letter is the set of Unicode letters.
Lm = _Lm; // Lm is the set of Unicode characters in category Lm.
Lo = _Lo; // Lo is the set of Unicode characters in category Lo.
Lower = _Ll; // Lower is the set of Unicode lower case letters.
Ll = _Ll; // Ll is the set of Unicode characters in category Ll.
Mc = _Mc; // Mc is the set of Unicode characters in category Mc.
Me = _Me; // Me is the set of Unicode characters in category Me.
Mn = _Mn; // Mn is the set of Unicode characters in category Mn.
Nl = _Nl; // Nl is the set of Unicode characters in category Nl.
No = _No; // No is the set of Unicode characters in category No.
Pc = _Pc; // Pc is the set of Unicode characters in category Pc.
Pd = _Pd; // Pd is the set of Unicode characters in category Pd.
Pe = _Pe; // Pe is the set of Unicode characters in category Pe.
Pf = _Pf; // Pf is the set of Unicode characters in category Pf.
Pi = _Pi; // Pi is the set of Unicode characters in category Pi.
Po = _Po; // Po is the set of Unicode characters in category Po.
Ps = _Ps; // Ps is the set of Unicode characters in category Ps.
Sc = _Sc; // Sc is the set of Unicode characters in category Sc.
Sk = _Sk; // Sk is the set of Unicode characters in category Sk.
Sm = _Sm; // Sm is the set of Unicode characters in category Sm.
So = _So; // So is the set of Unicode characters in category So.
Title = _Lt; // Title is the set of Unicode title case letters.
Lt = _Lt; // Lt is the set of Unicode characters in category Lt.
Upper = _Lu; // Upper is the set of Unicode upper case letters.
Lu = _Lu; // Lu is the set of Unicode characters in category Lu.
Zl = _Zl; // Zl is the set of Unicode characters in category Zl.
Zp = _Zp; // Zp is the set of Unicode characters in category Zp.
Zs = _Zs; // Zs is the set of Unicode characters in category Zs.
Cc = _Cc // Cc is the set of Unicode characters in category Cc.
Cf = _Cf // Cf is the set of Unicode characters in category Cf.
Co = _Co // Co is the set of Unicode characters in category Co.
Cs = _Cs // Cs is the set of Unicode characters in category Cs.
Digit = _Nd // Digit is the set of Unicode characters with the "decimal digit" property.
Nd = _Nd // Nd is the set of Unicode characters in category Nd.
Letter = letter // Letter is the set of Unicode letters.
Lm = _Lm // Lm is the set of Unicode characters in category Lm.
Lo = _Lo // Lo is the set of Unicode characters in category Lo.
Lower = _Ll // Lower is the set of Unicode lower case letters.
Ll = _Ll // Ll is the set of Unicode characters in category Ll.
Mc = _Mc // Mc is the set of Unicode characters in category Mc.
Me = _Me // Me is the set of Unicode characters in category Me.
Mn = _Mn // Mn is the set of Unicode characters in category Mn.
Nl = _Nl // Nl is the set of Unicode characters in category Nl.
No = _No // No is the set of Unicode characters in category No.
Pc = _Pc // Pc is the set of Unicode characters in category Pc.
Pd = _Pd // Pd is the set of Unicode characters in category Pd.
Pe = _Pe // Pe is the set of Unicode characters in category Pe.
Pf = _Pf // Pf is the set of Unicode characters in category Pf.
Pi = _Pi // Pi is the set of Unicode characters in category Pi.
Po = _Po // Po is the set of Unicode characters in category Po.
Ps = _Ps // Ps is the set of Unicode characters in category Ps.
Sc = _Sc // Sc is the set of Unicode characters in category Sc.
Sk = _Sk // Sk is the set of Unicode characters in category Sk.
Sm = _Sm // Sm is the set of Unicode characters in category Sm.
So = _So // So is the set of Unicode characters in category So.
Title = _Lt // Title is the set of Unicode title case letters.
Lt = _Lt // Lt is the set of Unicode characters in category Lt.
Upper = _Lu // Upper is the set of Unicode upper case letters.
Lu = _Lu // Lu is the set of Unicode characters in category Lu.
Zl = _Zl // Zl is the set of Unicode characters in category Zl.
Zp = _Zp // Zp is the set of Unicode characters in category Zp.
Zs = _Zs // Zs is the set of Unicode characters in category Zs.
)
// Generated by running
@ -2990,98 +2990,98 @@ var _Gothic = []Range{
}
var (
Arabic = _Arabic; // Arabic is the set of Unicode characters in script Arabic.
Armenian = _Armenian; // Armenian is the set of Unicode characters in script Armenian.
Avestan = _Avestan; // Avestan is the set of Unicode characters in script Avestan.
Balinese = _Balinese; // Balinese is the set of Unicode characters in script Balinese.
Bamum = _Bamum; // Bamum is the set of Unicode characters in script Bamum.
Bengali = _Bengali; // Bengali is the set of Unicode characters in script Bengali.
Bopomofo = _Bopomofo; // Bopomofo is the set of Unicode characters in script Bopomofo.
Braille = _Braille; // Braille is the set of Unicode characters in script Braille.
Buginese = _Buginese; // Buginese is the set of Unicode characters in script Buginese.
Buhid = _Buhid; // Buhid is the set of Unicode characters in script Buhid.
Canadian_Aboriginal = _Canadian_Aboriginal; // Canadian_Aboriginal is the set of Unicode characters in script Canadian_Aboriginal.
Carian = _Carian; // Carian is the set of Unicode characters in script Carian.
Cham = _Cham; // Cham is the set of Unicode characters in script Cham.
Cherokee = _Cherokee; // Cherokee is the set of Unicode characters in script Cherokee.
Common = _Common; // Common is the set of Unicode characters in script Common.
Coptic = _Coptic; // Coptic is the set of Unicode characters in script Coptic.
Cuneiform = _Cuneiform; // Cuneiform is the set of Unicode characters in script Cuneiform.
Cypriot = _Cypriot; // Cypriot is the set of Unicode characters in script Cypriot.
Cyrillic = _Cyrillic; // Cyrillic is the set of Unicode characters in script Cyrillic.
Deseret = _Deseret; // Deseret is the set of Unicode characters in script Deseret.
Devanagari = _Devanagari; // Devanagari is the set of Unicode characters in script Devanagari.
Egyptian_Hieroglyphs = _Egyptian_Hieroglyphs; // Egyptian_Hieroglyphs is the set of Unicode characters in script Egyptian_Hieroglyphs.
Ethiopic = _Ethiopic; // Ethiopic is the set of Unicode characters in script Ethiopic.
Georgian = _Georgian; // Georgian is the set of Unicode characters in script Georgian.
Glagolitic = _Glagolitic; // Glagolitic is the set of Unicode characters in script Glagolitic.
Gothic = _Gothic; // Gothic is the set of Unicode characters in script Gothic.
Greek = _Greek; // Greek is the set of Unicode characters in script Greek.
Gujarati = _Gujarati; // Gujarati is the set of Unicode characters in script Gujarati.
Gurmukhi = _Gurmukhi; // Gurmukhi is the set of Unicode characters in script Gurmukhi.
Han = _Han; // Han is the set of Unicode characters in script Han.
Hangul = _Hangul; // Hangul is the set of Unicode characters in script Hangul.
Hanunoo = _Hanunoo; // Hanunoo is the set of Unicode characters in script Hanunoo.
Hebrew = _Hebrew; // Hebrew is the set of Unicode characters in script Hebrew.
Hiragana = _Hiragana; // Hiragana is the set of Unicode characters in script Hiragana.
Imperial_Aramaic = _Imperial_Aramaic; // Imperial_Aramaic is the set of Unicode characters in script Imperial_Aramaic.
Inherited = _Inherited; // Inherited is the set of Unicode characters in script Inherited.
Inscriptional_Pahlavi = _Inscriptional_Pahlavi; // Inscriptional_Pahlavi is the set of Unicode characters in script Inscriptional_Pahlavi.
Inscriptional_Parthian = _Inscriptional_Parthian; // Inscriptional_Parthian is the set of Unicode characters in script Inscriptional_Parthian.
Javanese = _Javanese; // Javanese is the set of Unicode characters in script Javanese.
Kaithi = _Kaithi; // Kaithi is the set of Unicode characters in script Kaithi.
Kannada = _Kannada; // Kannada is the set of Unicode characters in script Kannada.
Katakana = _Katakana; // Katakana is the set of Unicode characters in script Katakana.
Kayah_Li = _Kayah_Li; // Kayah_Li is the set of Unicode characters in script Kayah_Li.
Kharoshthi = _Kharoshthi; // Kharoshthi is the set of Unicode characters in script Kharoshthi.
Khmer = _Khmer; // Khmer is the set of Unicode characters in script Khmer.
Lao = _Lao; // Lao is the set of Unicode characters in script Lao.
Latin = _Latin; // Latin is the set of Unicode characters in script Latin.
Lepcha = _Lepcha; // Lepcha is the set of Unicode characters in script Lepcha.
Limbu = _Limbu; // Limbu is the set of Unicode characters in script Limbu.
Linear_B = _Linear_B; // Linear_B is the set of Unicode characters in script Linear_B.
Lisu = _Lisu; // Lisu is the set of Unicode characters in script Lisu.
Lycian = _Lycian; // Lycian is the set of Unicode characters in script Lycian.
Lydian = _Lydian; // Lydian is the set of Unicode characters in script Lydian.
Malayalam = _Malayalam; // Malayalam is the set of Unicode characters in script Malayalam.
Meetei_Mayek = _Meetei_Mayek; // Meetei_Mayek is the set of Unicode characters in script Meetei_Mayek.
Mongolian = _Mongolian; // Mongolian is the set of Unicode characters in script Mongolian.
Myanmar = _Myanmar; // Myanmar is the set of Unicode characters in script Myanmar.
New_Tai_Lue = _New_Tai_Lue; // New_Tai_Lue is the set of Unicode characters in script New_Tai_Lue.
Nko = _Nko; // Nko is the set of Unicode characters in script Nko.
Ogham = _Ogham; // Ogham is the set of Unicode characters in script Ogham.
Ol_Chiki = _Ol_Chiki; // Ol_Chiki is the set of Unicode characters in script Ol_Chiki.
Old_Italic = _Old_Italic; // Old_Italic is the set of Unicode characters in script Old_Italic.
Old_Persian = _Old_Persian; // Old_Persian is the set of Unicode characters in script Old_Persian.
Old_South_Arabian = _Old_South_Arabian; // Old_South_Arabian is the set of Unicode characters in script Old_South_Arabian.
Old_Turkic = _Old_Turkic; // Old_Turkic is the set of Unicode characters in script Old_Turkic.
Oriya = _Oriya; // Oriya is the set of Unicode characters in script Oriya.
Osmanya = _Osmanya; // Osmanya is the set of Unicode characters in script Osmanya.
Phags_Pa = _Phags_Pa; // Phags_Pa is the set of Unicode characters in script Phags_Pa.
Phoenician = _Phoenician; // Phoenician is the set of Unicode characters in script Phoenician.
Rejang = _Rejang; // Rejang is the set of Unicode characters in script Rejang.
Runic = _Runic; // Runic is the set of Unicode characters in script Runic.
Samaritan = _Samaritan; // Samaritan is the set of Unicode characters in script Samaritan.
Saurashtra = _Saurashtra; // Saurashtra is the set of Unicode characters in script Saurashtra.
Shavian = _Shavian; // Shavian is the set of Unicode characters in script Shavian.
Sinhala = _Sinhala; // Sinhala is the set of Unicode characters in script Sinhala.
Sundanese = _Sundanese; // Sundanese is the set of Unicode characters in script Sundanese.
Syloti_Nagri = _Syloti_Nagri; // Syloti_Nagri is the set of Unicode characters in script Syloti_Nagri.
Syriac = _Syriac; // Syriac is the set of Unicode characters in script Syriac.
Tagalog = _Tagalog; // Tagalog is the set of Unicode characters in script Tagalog.
Tagbanwa = _Tagbanwa; // Tagbanwa is the set of Unicode characters in script Tagbanwa.
Tai_Le = _Tai_Le; // Tai_Le is the set of Unicode characters in script Tai_Le.
Tai_Tham = _Tai_Tham; // Tai_Tham is the set of Unicode characters in script Tai_Tham.
Tai_Viet = _Tai_Viet; // Tai_Viet is the set of Unicode characters in script Tai_Viet.
Tamil = _Tamil; // Tamil is the set of Unicode characters in script Tamil.
Telugu = _Telugu; // Telugu is the set of Unicode characters in script Telugu.
Thaana = _Thaana; // Thaana is the set of Unicode characters in script Thaana.
Thai = _Thai; // Thai is the set of Unicode characters in script Thai.
Tibetan = _Tibetan; // Tibetan is the set of Unicode characters in script Tibetan.
Tifinagh = _Tifinagh; // Tifinagh is the set of Unicode characters in script Tifinagh.
Ugaritic = _Ugaritic; // Ugaritic is the set of Unicode characters in script Ugaritic.
Vai = _Vai; // Vai is the set of Unicode characters in script Vai.
Yi = _Yi; // Yi is the set of Unicode characters in script Yi.
Arabic = _Arabic // Arabic is the set of Unicode characters in script Arabic.
Armenian = _Armenian // Armenian is the set of Unicode characters in script Armenian.
Avestan = _Avestan // Avestan is the set of Unicode characters in script Avestan.
Balinese = _Balinese // Balinese is the set of Unicode characters in script Balinese.
Bamum = _Bamum // Bamum is the set of Unicode characters in script Bamum.
Bengali = _Bengali // Bengali is the set of Unicode characters in script Bengali.
Bopomofo = _Bopomofo // Bopomofo is the set of Unicode characters in script Bopomofo.
Braille = _Braille // Braille is the set of Unicode characters in script Braille.
Buginese = _Buginese // Buginese is the set of Unicode characters in script Buginese.
Buhid = _Buhid // Buhid is the set of Unicode characters in script Buhid.
Canadian_Aboriginal = _Canadian_Aboriginal // Canadian_Aboriginal is the set of Unicode characters in script Canadian_Aboriginal.
Carian = _Carian // Carian is the set of Unicode characters in script Carian.
Cham = _Cham // Cham is the set of Unicode characters in script Cham.
Cherokee = _Cherokee // Cherokee is the set of Unicode characters in script Cherokee.
Common = _Common // Common is the set of Unicode characters in script Common.
Coptic = _Coptic // Coptic is the set of Unicode characters in script Coptic.
Cuneiform = _Cuneiform // Cuneiform is the set of Unicode characters in script Cuneiform.
Cypriot = _Cypriot // Cypriot is the set of Unicode characters in script Cypriot.
Cyrillic = _Cyrillic // Cyrillic is the set of Unicode characters in script Cyrillic.
Deseret = _Deseret // Deseret is the set of Unicode characters in script Deseret.
Devanagari = _Devanagari // Devanagari is the set of Unicode characters in script Devanagari.
Egyptian_Hieroglyphs = _Egyptian_Hieroglyphs // Egyptian_Hieroglyphs is the set of Unicode characters in script Egyptian_Hieroglyphs.
Ethiopic = _Ethiopic // Ethiopic is the set of Unicode characters in script Ethiopic.
Georgian = _Georgian // Georgian is the set of Unicode characters in script Georgian.
Glagolitic = _Glagolitic // Glagolitic is the set of Unicode characters in script Glagolitic.
Gothic = _Gothic // Gothic is the set of Unicode characters in script Gothic.
Greek = _Greek // Greek is the set of Unicode characters in script Greek.
Gujarati = _Gujarati // Gujarati is the set of Unicode characters in script Gujarati.
Gurmukhi = _Gurmukhi // Gurmukhi is the set of Unicode characters in script Gurmukhi.
Han = _Han // Han is the set of Unicode characters in script Han.
Hangul = _Hangul // Hangul is the set of Unicode characters in script Hangul.
Hanunoo = _Hanunoo // Hanunoo is the set of Unicode characters in script Hanunoo.
Hebrew = _Hebrew // Hebrew is the set of Unicode characters in script Hebrew.
Hiragana = _Hiragana // Hiragana is the set of Unicode characters in script Hiragana.
Imperial_Aramaic = _Imperial_Aramaic // Imperial_Aramaic is the set of Unicode characters in script Imperial_Aramaic.
Inherited = _Inherited // Inherited is the set of Unicode characters in script Inherited.
Inscriptional_Pahlavi = _Inscriptional_Pahlavi // Inscriptional_Pahlavi is the set of Unicode characters in script Inscriptional_Pahlavi.
Inscriptional_Parthian = _Inscriptional_Parthian // Inscriptional_Parthian is the set of Unicode characters in script Inscriptional_Parthian.
Javanese = _Javanese // Javanese is the set of Unicode characters in script Javanese.
Kaithi = _Kaithi // Kaithi is the set of Unicode characters in script Kaithi.
Kannada = _Kannada // Kannada is the set of Unicode characters in script Kannada.
Katakana = _Katakana // Katakana is the set of Unicode characters in script Katakana.
Kayah_Li = _Kayah_Li // Kayah_Li is the set of Unicode characters in script Kayah_Li.
Kharoshthi = _Kharoshthi // Kharoshthi is the set of Unicode characters in script Kharoshthi.
Khmer = _Khmer // Khmer is the set of Unicode characters in script Khmer.
Lao = _Lao // Lao is the set of Unicode characters in script Lao.
Latin = _Latin // Latin is the set of Unicode characters in script Latin.
Lepcha = _Lepcha // Lepcha is the set of Unicode characters in script Lepcha.
Limbu = _Limbu // Limbu is the set of Unicode characters in script Limbu.
Linear_B = _Linear_B // Linear_B is the set of Unicode characters in script Linear_B.
Lisu = _Lisu // Lisu is the set of Unicode characters in script Lisu.
Lycian = _Lycian // Lycian is the set of Unicode characters in script Lycian.
Lydian = _Lydian // Lydian is the set of Unicode characters in script Lydian.
Malayalam = _Malayalam // Malayalam is the set of Unicode characters in script Malayalam.
Meetei_Mayek = _Meetei_Mayek // Meetei_Mayek is the set of Unicode characters in script Meetei_Mayek.
Mongolian = _Mongolian // Mongolian is the set of Unicode characters in script Mongolian.
Myanmar = _Myanmar // Myanmar is the set of Unicode characters in script Myanmar.
New_Tai_Lue = _New_Tai_Lue // New_Tai_Lue is the set of Unicode characters in script New_Tai_Lue.
Nko = _Nko // Nko is the set of Unicode characters in script Nko.
Ogham = _Ogham // Ogham is the set of Unicode characters in script Ogham.
Ol_Chiki = _Ol_Chiki // Ol_Chiki is the set of Unicode characters in script Ol_Chiki.
Old_Italic = _Old_Italic // Old_Italic is the set of Unicode characters in script Old_Italic.
Old_Persian = _Old_Persian // Old_Persian is the set of Unicode characters in script Old_Persian.
Old_South_Arabian = _Old_South_Arabian // Old_South_Arabian is the set of Unicode characters in script Old_South_Arabian.
Old_Turkic = _Old_Turkic // Old_Turkic is the set of Unicode characters in script Old_Turkic.
Oriya = _Oriya // Oriya is the set of Unicode characters in script Oriya.
Osmanya = _Osmanya // Osmanya is the set of Unicode characters in script Osmanya.
Phags_Pa = _Phags_Pa // Phags_Pa is the set of Unicode characters in script Phags_Pa.
Phoenician = _Phoenician // Phoenician is the set of Unicode characters in script Phoenician.
Rejang = _Rejang // Rejang is the set of Unicode characters in script Rejang.
Runic = _Runic // Runic is the set of Unicode characters in script Runic.
Samaritan = _Samaritan // Samaritan is the set of Unicode characters in script Samaritan.
Saurashtra = _Saurashtra // Saurashtra is the set of Unicode characters in script Saurashtra.
Shavian = _Shavian // Shavian is the set of Unicode characters in script Shavian.
Sinhala = _Sinhala // Sinhala is the set of Unicode characters in script Sinhala.
Sundanese = _Sundanese // Sundanese is the set of Unicode characters in script Sundanese.
Syloti_Nagri = _Syloti_Nagri // Syloti_Nagri is the set of Unicode characters in script Syloti_Nagri.
Syriac = _Syriac // Syriac is the set of Unicode characters in script Syriac.
Tagalog = _Tagalog // Tagalog is the set of Unicode characters in script Tagalog.
Tagbanwa = _Tagbanwa // Tagbanwa is the set of Unicode characters in script Tagbanwa.
Tai_Le = _Tai_Le // Tai_Le is the set of Unicode characters in script Tai_Le.
Tai_Tham = _Tai_Tham // Tai_Tham is the set of Unicode characters in script Tai_Tham.
Tai_Viet = _Tai_Viet // Tai_Viet is the set of Unicode characters in script Tai_Viet.
Tamil = _Tamil // Tamil is the set of Unicode characters in script Tamil.
Telugu = _Telugu // Telugu is the set of Unicode characters in script Telugu.
Thaana = _Thaana // Thaana is the set of Unicode characters in script Thaana.
Thai = _Thai // Thai is the set of Unicode characters in script Thai.
Tibetan = _Tibetan // Tibetan is the set of Unicode characters in script Tibetan.
Tifinagh = _Tifinagh // Tifinagh is the set of Unicode characters in script Tifinagh.
Ugaritic = _Ugaritic // Ugaritic is the set of Unicode characters in script Ugaritic.
Vai = _Vai // Vai is the set of Unicode characters in script Vai.
Yi = _Yi // Yi is the set of Unicode characters in script Yi.
)
// Generated by running
@ -3943,38 +3943,38 @@ var _White_Space = []Range{
}
var (
ASCII_Hex_Digit = _ASCII_Hex_Digit; // ASCII_Hex_Digit is the set of Unicode characters with property ASCII_Hex_Digit.
Bidi_Control = _Bidi_Control; // Bidi_Control is the set of Unicode characters with property Bidi_Control.
Dash = _Dash; // Dash is the set of Unicode characters with property Dash.
Deprecated = _Deprecated; // Deprecated is the set of Unicode characters with property Deprecated.
Diacritic = _Diacritic; // Diacritic is the set of Unicode characters with property Diacritic.
Extender = _Extender; // Extender is the set of Unicode characters with property Extender.
Hex_Digit = _Hex_Digit; // Hex_Digit is the set of Unicode characters with property Hex_Digit.
Hyphen = _Hyphen; // Hyphen is the set of Unicode characters with property Hyphen.
IDS_Binary_Operator = _IDS_Binary_Operator; // IDS_Binary_Operator is the set of Unicode characters with property IDS_Binary_Operator.
IDS_Trinary_Operator = _IDS_Trinary_Operator; // IDS_Trinary_Operator is the set of Unicode characters with property IDS_Trinary_Operator.
Ideographic = _Ideographic; // Ideographic is the set of Unicode characters with property Ideographic.
Join_Control = _Join_Control; // Join_Control is the set of Unicode characters with property Join_Control.
Logical_Order_Exception = _Logical_Order_Exception; // Logical_Order_Exception is the set of Unicode characters with property Logical_Order_Exception.
Noncharacter_Code_Point = _Noncharacter_Code_Point; // Noncharacter_Code_Point is the set of Unicode characters with property Noncharacter_Code_Point.
Other_Alphabetic = _Other_Alphabetic; // Other_Alphabetic is the set of Unicode characters with property Other_Alphabetic.
Other_Default_Ignorable_Code_Point = _Other_Default_Ignorable_Code_Point; // Other_Default_Ignorable_Code_Point is the set of Unicode characters with property Other_Default_Ignorable_Code_Point.
Other_Grapheme_Extend = _Other_Grapheme_Extend; // Other_Grapheme_Extend is the set of Unicode characters with property Other_Grapheme_Extend.
Other_ID_Continue = _Other_ID_Continue; // Other_ID_Continue is the set of Unicode characters with property Other_ID_Continue.
Other_ID_Start = _Other_ID_Start; // Other_ID_Start is the set of Unicode characters with property Other_ID_Start.
Other_Lowercase = _Other_Lowercase; // Other_Lowercase is the set of Unicode characters with property Other_Lowercase.
Other_Math = _Other_Math; // Other_Math is the set of Unicode characters with property Other_Math.
Other_Uppercase = _Other_Uppercase; // Other_Uppercase is the set of Unicode characters with property Other_Uppercase.
Pattern_Syntax = _Pattern_Syntax; // Pattern_Syntax is the set of Unicode characters with property Pattern_Syntax.
Pattern_White_Space = _Pattern_White_Space; // Pattern_White_Space is the set of Unicode characters with property Pattern_White_Space.
Quotation_Mark = _Quotation_Mark; // Quotation_Mark is the set of Unicode characters with property Quotation_Mark.
Radical = _Radical; // Radical is the set of Unicode characters with property Radical.
STerm = _STerm; // STerm is the set of Unicode characters with property STerm.
Soft_Dotted = _Soft_Dotted; // Soft_Dotted is the set of Unicode characters with property Soft_Dotted.
Terminal_Punctuation = _Terminal_Punctuation; // Terminal_Punctuation is the set of Unicode characters with property Terminal_Punctuation.
Unified_Ideograph = _Unified_Ideograph; // Unified_Ideograph is the set of Unicode characters with property Unified_Ideograph.
Variation_Selector = _Variation_Selector; // Variation_Selector is the set of Unicode characters with property Variation_Selector.
White_Space = _White_Space; // White_Space is the set of Unicode characters with property White_Space.
ASCII_Hex_Digit = _ASCII_Hex_Digit // ASCII_Hex_Digit is the set of Unicode characters with property ASCII_Hex_Digit.
Bidi_Control = _Bidi_Control // Bidi_Control is the set of Unicode characters with property Bidi_Control.
Dash = _Dash // Dash is the set of Unicode characters with property Dash.
Deprecated = _Deprecated // Deprecated is the set of Unicode characters with property Deprecated.
Diacritic = _Diacritic // Diacritic is the set of Unicode characters with property Diacritic.
Extender = _Extender // Extender is the set of Unicode characters with property Extender.
Hex_Digit = _Hex_Digit // Hex_Digit is the set of Unicode characters with property Hex_Digit.
Hyphen = _Hyphen // Hyphen is the set of Unicode characters with property Hyphen.
IDS_Binary_Operator = _IDS_Binary_Operator // IDS_Binary_Operator is the set of Unicode characters with property IDS_Binary_Operator.
IDS_Trinary_Operator = _IDS_Trinary_Operator // IDS_Trinary_Operator is the set of Unicode characters with property IDS_Trinary_Operator.
Ideographic = _Ideographic // Ideographic is the set of Unicode characters with property Ideographic.
Join_Control = _Join_Control // Join_Control is the set of Unicode characters with property Join_Control.
Logical_Order_Exception = _Logical_Order_Exception // Logical_Order_Exception is the set of Unicode characters with property Logical_Order_Exception.
Noncharacter_Code_Point = _Noncharacter_Code_Point // Noncharacter_Code_Point is the set of Unicode characters with property Noncharacter_Code_Point.
Other_Alphabetic = _Other_Alphabetic // Other_Alphabetic is the set of Unicode characters with property Other_Alphabetic.
Other_Default_Ignorable_Code_Point = _Other_Default_Ignorable_Code_Point // Other_Default_Ignorable_Code_Point is the set of Unicode characters with property Other_Default_Ignorable_Code_Point.
Other_Grapheme_Extend = _Other_Grapheme_Extend // Other_Grapheme_Extend is the set of Unicode characters with property Other_Grapheme_Extend.
Other_ID_Continue = _Other_ID_Continue // Other_ID_Continue is the set of Unicode characters with property Other_ID_Continue.
Other_ID_Start = _Other_ID_Start // Other_ID_Start is the set of Unicode characters with property Other_ID_Start.
Other_Lowercase = _Other_Lowercase // Other_Lowercase is the set of Unicode characters with property Other_Lowercase.
Other_Math = _Other_Math // Other_Math is the set of Unicode characters with property Other_Math.
Other_Uppercase = _Other_Uppercase // Other_Uppercase is the set of Unicode characters with property Other_Uppercase.
Pattern_Syntax = _Pattern_Syntax // Pattern_Syntax is the set of Unicode characters with property Pattern_Syntax.
Pattern_White_Space = _Pattern_White_Space // Pattern_White_Space is the set of Unicode characters with property Pattern_White_Space.
Quotation_Mark = _Quotation_Mark // Quotation_Mark is the set of Unicode characters with property Quotation_Mark.
Radical = _Radical // Radical is the set of Unicode characters with property Radical.
STerm = _STerm // STerm is the set of Unicode characters with property STerm.
Soft_Dotted = _Soft_Dotted // Soft_Dotted is the set of Unicode characters with property Soft_Dotted.
Terminal_Punctuation = _Terminal_Punctuation // Terminal_Punctuation is the set of Unicode characters with property Terminal_Punctuation.
Unified_Ideograph = _Unified_Ideograph // Unified_Ideograph is the set of Unicode characters with property Unified_Ideograph.
Variation_Selector = _Variation_Selector // Variation_Selector is the set of Unicode characters with property Variation_Selector.
White_Space = _White_Space // White_Space is the set of Unicode characters with property White_Space.
)
// Generated by running

146
src/pkg/utf8/utf8.go
View file

@ -6,40 +6,40 @@
// This package calls a Unicode character a rune for brevity.
package utf8
import "unicode" // only needed for a couple of constants
import "unicode" // only needed for a couple of constants
// Numbers fundamental to the encoding.
const (
RuneError = unicode.ReplacementChar; // the "error" Rune or "replacement character".
RuneSelf = 0x80; // characters below Runeself are represented as themselves in a single byte.
UTFMax = 4; // maximum number of bytes of a UTF-8 encoded Unicode character.
RuneError = unicode.ReplacementChar // the "error" Rune or "replacement character".
RuneSelf = 0x80 // characters below Runeself are represented as themselves in a single byte.
UTFMax = 4 // maximum number of bytes of a UTF-8 encoded Unicode character.
)
const (
_T1 = 0x00; // 0000 0000
_Tx = 0x80; // 1000 0000
_T2 = 0xC0; // 1100 0000
_T3 = 0xE0; // 1110 0000
_T4 = 0xF0; // 1111 0000
_T5 = 0xF8; // 1111 1000
_T1 = 0x00 // 0000 0000
_Tx = 0x80 // 1000 0000
_T2 = 0xC0 // 1100 0000
_T3 = 0xE0 // 1110 0000
_T4 = 0xF0 // 1111 0000
_T5 = 0xF8 // 1111 1000
_Maskx = 0x3F; // 0011 1111
_Mask2 = 0x1F; // 0001 1111
_Mask3 = 0x0F; // 0000 1111
_Mask4 = 0x07; // 0000 0111
_Maskx = 0x3F // 0011 1111
_Mask2 = 0x1F // 0001 1111
_Mask3 = 0x0F // 0000 1111
_Mask4 = 0x07 // 0000 0111
_Rune1Max = 1<<7 - 1;
_Rune2Max = 1<<11 - 1;
_Rune3Max = 1<<16 - 1;
_Rune4Max = 1<<21 - 1;
_Rune1Max = 1<<7 - 1
_Rune2Max = 1<<11 - 1
_Rune3Max = 1<<16 - 1
_Rune4Max = 1<<21 - 1
)
func decodeRuneInternal(p []byte) (rune, size int, short bool) {
n := len(p);
n := len(p)
if n < 1 {
return RuneError, 0, true
}
c0 := p[0];
c0 := p[0]
// 1-byte, 7-bit sequence?
if c0 < _Tx {
@ -55,66 +55,66 @@ func decodeRuneInternal(p []byte) (rune, size int, short bool) {
if n < 2 {
return RuneError, 1, true
}
c1 := p[1];
c1 := p[1]
if c1 < _Tx || _T2 <= c1 {
return RuneError, 1, false
}
// 2-byte, 11-bit sequence?
if c0 < _T3 {
rune = int(c0&_Mask2)<<6 | int(c1&_Maskx);
rune = int(c0&_Mask2)<<6 | int(c1&_Maskx)
if rune <= _Rune1Max {
return RuneError, 1, false
}
return rune, 2, false;
return rune, 2, false
}
// need second continuation byte
if n < 3 {
return RuneError, 1, true
}
c2 := p[2];
c2 := p[2]
if c2 < _Tx || _T2 <= c2 {
return RuneError, 1, false
}
// 3-byte, 16-bit sequence?
if c0 < _T4 {
rune = int(c0&_Mask3)<<12 | int(c1&_Maskx)<<6 | int(c2&_Maskx);
rune = int(c0&_Mask3)<<12 | int(c1&_Maskx)<<6 | int(c2&_Maskx)
if rune <= _Rune2Max {
return RuneError, 1, false
}
return rune, 3, false;
return rune, 3, false
}
// need third continuation byte
if n < 4 {
return RuneError, 1, true
}
c3 := p[3];
c3 := p[3]
if c3 < _Tx || _T2 <= c3 {
return RuneError, 1, false
}
// 4-byte, 21-bit sequence?
if c0 < _T5 {
rune = int(c0&_Mask4)<<18 | int(c1&_Maskx)<<12 | int(c2&_Maskx)<<6 | int(c3&_Maskx);
rune = int(c0&_Mask4)<<18 | int(c1&_Maskx)<<12 | int(c2&_Maskx)<<6 | int(c3&_Maskx)
if rune <= _Rune3Max {
return RuneError, 1, false
}
return rune, 4, false;
return rune, 4, false
}
// error
return RuneError, 1, false;
return RuneError, 1, false
}
func decodeRuneInStringInternal(s string) (rune, size int, short bool) {
n := len(s);
n := len(s)
if n < 1 {
return RuneError, 0, true
}
c0 := s[0];
c0 := s[0]
// 1-byte, 7-bit sequence?
if c0 < _Tx {
@ -130,83 +130,83 @@ func decodeRuneInStringInternal(s string) (rune, size int, short bool) {
if n < 2 {
return RuneError, 1, true
}
c1 := s[1];
c1 := s[1]
if c1 < _Tx || _T2 <= c1 {
return RuneError, 1, false
}
// 2-byte, 11-bit sequence?
if c0 < _T3 {
rune = int(c0&_Mask2)<<6 | int(c1&_Maskx);
rune = int(c0&_Mask2)<<6 | int(c1&_Maskx)
if rune <= _Rune1Max {
return RuneError, 1, false
}
return rune, 2, false;
return rune, 2, false
}
// need second continuation byte
if n < 3 {
return RuneError, 1, true
}
c2 := s[2];
c2 := s[2]
if c2 < _Tx || _T2 <= c2 {
return RuneError, 1, false
}
// 3-byte, 16-bit sequence?
if c0 < _T4 {
rune = int(c0&_Mask3)<<12 | int(c1&_Maskx)<<6 | int(c2&_Maskx);
rune = int(c0&_Mask3)<<12 | int(c1&_Maskx)<<6 | int(c2&_Maskx)
if rune <= _Rune2Max {
return RuneError, 1, false
}
return rune, 3, false;
return rune, 3, false
}
// need third continuation byte
if n < 4 {
return RuneError, 1, true
}
c3 := s[3];
c3 := s[3]
if c3 < _Tx || _T2 <= c3 {
return RuneError, 1, false
}
// 4-byte, 21-bit sequence?
if c0 < _T5 {
rune = int(c0&_Mask4)<<18 | int(c1&_Maskx)<<12 | int(c2&_Maskx)<<6 | int(c3&_Maskx);
rune = int(c0&_Mask4)<<18 | int(c1&_Maskx)<<12 | int(c2&_Maskx)<<6 | int(c3&_Maskx)
if rune <= _Rune3Max {
return RuneError, 1, false
}
return rune, 4, false;
return rune, 4, false
}
// error
return RuneError, 1, false;
return RuneError, 1, false
}
// FullRune reports whether the bytes in p begin with a full UTF-8 encoding of a rune.
// An invalid encoding is considered a full Rune since it will convert as a width-1 error rune.
func FullRune(p []byte) bool {
_, _, short := decodeRuneInternal(p);
return !short;
_, _, short := decodeRuneInternal(p)
return !short
}
// FullRuneInString is like FullRune but its input is a string.
func FullRuneInString(s string) bool {
_, _, short := decodeRuneInStringInternal(s);
return !short;
_, _, short := decodeRuneInStringInternal(s)
return !short
}
// DecodeRune unpacks the first UTF-8 encoding in p and returns the rune and its width in bytes.
func DecodeRune(p []byte) (rune, size int) {
rune, size, _ = decodeRuneInternal(p);
return;
rune, size, _ = decodeRuneInternal(p)
return
}
// DecodeRuneInString is like DecodeRune but its input is a string.
func DecodeRuneInString(s string) (rune, size int) {
rune, size, _ = decodeRuneInStringInternal(s);
return;
rune, size, _ = decodeRuneInStringInternal(s)
return
}
// RuneLen returns the number of bytes required to encode the rune.
@ -221,24 +221,24 @@ func RuneLen(rune int) int {
case rune <= _Rune4Max:
return 4
}
return -1;
return -1
}
// EncodeRune writes into p (which must be large enough) the UTF-8 encoding of the rune.
// It returns the number of bytes written.
func EncodeRune(rune int, p []byte) int {
// Negative values are erroneous. Making it unsigned addresses the problem.
r := uint(rune);
r := uint(rune)
if r <= _Rune1Max {
p[0] = byte(r);
return 1;
p[0] = byte(r)
return 1
}
if r <= _Rune2Max {
p[0] = _T2 | byte(r>>6);
p[1] = _Tx | byte(r)&_Maskx;
return 2;
p[0] = _T2 | byte(r>>6)
p[1] = _Tx | byte(r)&_Maskx
return 2
}
if r > unicode.MaxRune {
@ -246,33 +246,33 @@ func EncodeRune(rune int, p []byte) int {
}
if r <= _Rune3Max {
p[0] = _T3 | byte(r>>12);
p[1] = _Tx | byte(r>>6)&_Maskx;
p[2] = _Tx | byte(r)&_Maskx;
return 3;
p[0] = _T3 | byte(r>>12)
p[1] = _Tx | byte(r>>6)&_Maskx
p[2] = _Tx | byte(r)&_Maskx
return 3
}
p[0] = _T4 | byte(r>>18);
p[1] = _Tx | byte(r>>12)&_Maskx;
p[2] = _Tx | byte(r>>6)&_Maskx;
p[3] = _Tx | byte(r)&_Maskx;
return 4;
p[0] = _T4 | byte(r>>18)
p[1] = _Tx | byte(r>>12)&_Maskx
p[2] = _Tx | byte(r>>6)&_Maskx
p[3] = _Tx | byte(r)&_Maskx
return 4
}
// RuneCount returns the number of runes in p. Erroneous and short
// encodings are treated as single runes of width 1 byte.
func RuneCount(p []byte) int {
i := 0;
var n int;
i := 0
var n int
for n = 0; i < len(p); n++ {
if p[i] < RuneSelf {
i++
} else {
_, size := DecodeRune(p[i:]);
i += size;
_, size := DecodeRune(p[i:])
i += size
}
}
return n;
return n
}
// RuneCountInString is like RuneCount but its input is a string.
@ -280,10 +280,10 @@ func RuneCountInString(s string) (n int) {
for _ = range s {
n++
}
return;
return
}
// RuneStart reports whether the byte could be the first byte of
// an encoded rune. Second and subsequent bytes always have the top
// two bits set to 10.
func RuneStart(b byte) bool { return b&0xC0 != 0x80 }
func RuneStart(b byte) bool { return b&0xC0 != 0x80 }

90
src/pkg/utf8/utf8_test.go
View file

@ -5,15 +5,15 @@
package utf8_test
import (
"bytes";
"strings";
"testing";
. "utf8";
"bytes"
"strings"
"testing"
. "utf8"
)
type Utf8Map struct {
rune int;
str string;
rune int
str string
}
var utf8map = []Utf8Map{
@ -47,27 +47,27 @@ var utf8map = []Utf8Map{
// strings.Bytes with one extra byte at end
func makeBytes(s string) []byte {
s += "\x00";
b := strings.Bytes(s);
return b[0 : len(s)-1];
s += "\x00"
b := strings.Bytes(s)
return b[0 : len(s)-1]
}
func TestFullRune(t *testing.T) {
for i := 0; i < len(utf8map); i++ {
m := utf8map[i];
b := makeBytes(m.str);
m := utf8map[i]
b := makeBytes(m.str)
if !FullRune(b) {
t.Errorf("FullRune(%q) (rune %04x) = false, want true", b, m.rune)
}
s := m.str;
s := m.str
if !FullRuneInString(s) {
t.Errorf("FullRuneInString(%q) (rune %04x) = false, want true", s, m.rune)
}
b1 := b[0 : len(b)-1];
b1 := b[0 : len(b)-1]
if FullRune(b1) {
t.Errorf("FullRune(%q) = true, want false", b1)
}
s1 := string(b1);
s1 := string(b1)
if FullRuneInString(s1) {
t.Errorf("FullRune(%q) = true, want false", s1)
}
@ -76,11 +76,11 @@ func TestFullRune(t *testing.T) {
func TestEncodeRune(t *testing.T) {
for i := 0; i < len(utf8map); i++ {
m := utf8map[i];
b := makeBytes(m.str);
var buf [10]byte;
n := EncodeRune(m.rune, &buf);
b1 := buf[0:n];
m := utf8map[i]
b := makeBytes(m.str)
var buf [10]byte
n := EncodeRune(m.rune, &buf)
b1 := buf[0:n]
if !bytes.Equal(b, b1) {
t.Errorf("EncodeRune(%#04x) = %q want %q", m.rune, b1, b)
}
@ -89,40 +89,40 @@ func TestEncodeRune(t *testing.T) {
func TestDecodeRune(t *testing.T) {
for i := 0; i < len(utf8map); i++ {
m := utf8map[i];
b := makeBytes(m.str);
rune, size := DecodeRune(b);
m := utf8map[i]
b := makeBytes(m.str)
rune, size := DecodeRune(b)
if rune != m.rune || size != len(b) {
t.Errorf("DecodeRune(%q) = %#04x, %d want %#04x, %d", b, rune, size, m.rune, len(b))
}
s := m.str;
rune, size = DecodeRuneInString(s);
s := m.str
rune, size = DecodeRuneInString(s)
if rune != m.rune || size != len(b) {
t.Errorf("DecodeRune(%q) = %#04x, %d want %#04x, %d", s, rune, size, m.rune, len(b))
}
// there's an extra byte that bytes left behind - make sure trailing byte works
rune, size = DecodeRune(b[0:cap(b)]);
rune, size = DecodeRune(b[0:cap(b)])
if rune != m.rune || size != len(b) {
t.Errorf("DecodeRune(%q) = %#04x, %d want %#04x, %d", b, rune, size, m.rune, len(b))
}
s = m.str + "\x00";
rune, size = DecodeRuneInString(s);
s = m.str + "\x00"
rune, size = DecodeRuneInString(s)
if rune != m.rune || size != len(b) {
t.Errorf("DecodeRuneInString(%q) = %#04x, %d want %#04x, %d", s, rune, size, m.rune, len(b))
}
// make sure missing bytes fail
wantsize := 1;
wantsize := 1
if wantsize >= len(b) {
wantsize = 0
}
rune, size = DecodeRune(b[0 : len(b)-1]);
rune, size = DecodeRune(b[0 : len(b)-1])
if rune != RuneError || size != wantsize {
t.Errorf("DecodeRune(%q) = %#04x, %d want %#04x, %d", b[0:len(b)-1], rune, size, RuneError, wantsize)
}
s = m.str[0 : len(m.str)-1];
rune, size = DecodeRuneInString(s);
s = m.str[0 : len(m.str)-1]
rune, size = DecodeRuneInString(s)
if rune != RuneError || size != wantsize {
t.Errorf("DecodeRuneInString(%q) = %#04x, %d want %#04x, %d", s, rune, size, RuneError, wantsize)
}
@ -133,12 +133,12 @@ func TestDecodeRune(t *testing.T) {
} else {
b[len(b)-1] = 0x7F
}
rune, size = DecodeRune(b);
rune, size = DecodeRune(b)
if rune != RuneError || size != 1 {
t.Errorf("DecodeRune(%q) = %#04x, %d want %#04x, %d", b, rune, size, RuneError, 1)
}
s = string(b);
rune, size = DecodeRune(b);
s = string(b)
rune, size = DecodeRune(b)
if rune != RuneError || size != 1 {
t.Errorf("DecodeRuneInString(%q) = %#04x, %d want %#04x, %d", s, rune, size, RuneError, 1)
}
@ -147,18 +147,18 @@ func TestDecodeRune(t *testing.T) {
// Check that negative runes encode as U+FFFD.
func TestNegativeRune(t *testing.T) {
errorbuf := make([]byte, UTFMax);
errorbuf = errorbuf[0:EncodeRune(RuneError, errorbuf)];
buf := make([]byte, UTFMax);
buf = buf[0:EncodeRune(-1, buf)];
errorbuf := make([]byte, UTFMax)
errorbuf = errorbuf[0:EncodeRune(RuneError, errorbuf)]
buf := make([]byte, UTFMax)
buf = buf[0:EncodeRune(-1, buf)]
if !bytes.Equal(buf, errorbuf) {
t.Errorf("incorrect encoding [% x] for -1; expected [% x]", buf, errorbuf)
}
}
type RuneCountTest struct {
in string;
out int;
in string
out int
}
var runecounttests = []RuneCountTest{
@ -170,7 +170,7 @@ var runecounttests = []RuneCountTest{
func TestRuneCount(t *testing.T) {
for i := 0; i < len(runecounttests); i++ {
tt := runecounttests[i];
tt := runecounttests[i]
if out := RuneCountInString(tt.in); out != tt.out {
t.Errorf("RuneCountInString(%q) = %d, want %d", tt.in, out, tt.out)
}
@ -193,28 +193,28 @@ func BenchmarkRuneCountTenJapaneseChars(b *testing.B) {
}
func BenchmarkEncodeASCIIRune(b *testing.B) {
buf := make([]byte, UTFMax);
buf := make([]byte, UTFMax)
for i := 0; i < b.N; i++ {
EncodeRune('a', buf)
}
}
func BenchmarkEncodeJapaneseRune(b *testing.B) {
buf := make([]byte, UTFMax);
buf := make([]byte, UTFMax)
for i := 0; i < b.N; i++ {
EncodeRune('本', buf)
}
}
func BenchmarkDecodeASCIIRune(b *testing.B) {
a := []byte{'a'};
a := []byte{'a'}
for i := 0; i < b.N; i++ {
DecodeRune(a)
}
}
func BenchmarkDecodeJapaneseRune(b *testing.B) {
nihon := strings.Bytes("本");
nihon := strings.Bytes("本")
for i := 0; i < b.N; i++ {
DecodeRune(nihon)
}

76
src/pkg/websocket/client.go
View file

@ -5,40 +5,40 @@
package websocket
import (
"bufio";
"http";
"io";
"net";
"os";
"bufio"
"http"
"io"
"net"
"os"
)
type ProtocolError struct {
os.ErrorString;
os.ErrorString
}
var (
ErrBadStatus = &ProtocolError{"bad status"};
ErrNoUpgrade = &ProtocolError{"no upgrade"};
ErrBadUpgrade = &ProtocolError{"bad upgrade"};
ErrNoWebSocketOrigin = &ProtocolError{"no WebSocket-Origin"};
ErrBadWebSocketOrigin = &ProtocolError{"bad WebSocket-Origin"};
ErrNoWebSocketLocation = &ProtocolError{"no WebSocket-Location"};
ErrBadWebSocketLocation = &ProtocolError{"bad WebSocket-Location"};
ErrNoWebSocketProtocol = &ProtocolError{"no WebSocket-Protocol"};
ErrBadWebSocketProtocol = &ProtocolError{"bad WebSocket-Protocol"};
ErrBadStatus = &ProtocolError{"bad status"}
ErrNoUpgrade = &ProtocolError{"no upgrade"}
ErrBadUpgrade = &ProtocolError{"bad upgrade"}
ErrNoWebSocketOrigin = &ProtocolError{"no WebSocket-Origin"}
ErrBadWebSocketOrigin = &ProtocolError{"bad WebSocket-Origin"}
ErrNoWebSocketLocation = &ProtocolError{"no WebSocket-Location"}
ErrBadWebSocketLocation = &ProtocolError{"bad WebSocket-Location"}
ErrNoWebSocketProtocol = &ProtocolError{"no WebSocket-Protocol"}
ErrBadWebSocketProtocol = &ProtocolError{"bad WebSocket-Protocol"}
)
// newClient creates a new Web Socket client connection.
func newClient(resourceName, host, origin, location, protocol string, rwc io.ReadWriteCloser) (ws *Conn, err os.Error) {
br := bufio.NewReader(rwc);
bw := bufio.NewWriter(rwc);
err = handshake(resourceName, host, origin, location, protocol, br, bw);
br := bufio.NewReader(rwc)
bw := bufio.NewWriter(rwc)
err = handshake(resourceName, host, origin, location, protocol, br, bw)
if err != nil {
return
}
buf := bufio.NewReadWriter(br, bw);
ws = newConn(origin, location, protocol, buf, rwc);
return;
buf := bufio.NewReadWriter(br, bw)
ws = newConn(origin, location, protocol, buf, rwc)
return
}
// Dial opens new Web Socket client connection.
@ -68,55 +68,55 @@ func newClient(resourceName, host, origin, location, protocol string, rwc io.Rea
// }
func Dial(url, protocol, origin string) (ws *Conn, err os.Error) {
parsedUrl, err := http.ParseURL(url);
parsedUrl, err := http.ParseURL(url)
if err != nil {
return
}
client, err := net.Dial("tcp", "", parsedUrl.Host);
client, err := net.Dial("tcp", "", parsedUrl.Host)
if err != nil {
return
}
return newClient(parsedUrl.Path, parsedUrl.Host, origin, url, protocol, client);
return newClient(parsedUrl.Path, parsedUrl.Host, origin, url, protocol, client)
}
func handshake(resourceName, host, origin, location, protocol string, br *bufio.Reader, bw *bufio.Writer) (err os.Error) {
bw.WriteString("GET " + resourceName + " HTTP/1.1\r\n");
bw.WriteString("Upgrade: WebSocket\r\n");
bw.WriteString("Connection: Upgrade\r\n");
bw.WriteString("Host: " + host + "\r\n");
bw.WriteString("Origin: " + origin + "\r\n");
bw.WriteString("GET " + resourceName + " HTTP/1.1\r\n")
bw.WriteString("Upgrade: WebSocket\r\n")
bw.WriteString("Connection: Upgrade\r\n")
bw.WriteString("Host: " + host + "\r\n")
bw.WriteString("Origin: " + origin + "\r\n")
if protocol != "" {
bw.WriteString("WebSocket-Protocol: " + protocol + "\r\n")
}
bw.WriteString("\r\n");
bw.Flush();
resp, err := http.ReadResponse(br);
bw.WriteString("\r\n")
bw.Flush()
resp, err := http.ReadResponse(br)
if err != nil {
return
}
if resp.Status != "101 Web Socket Protocol Handshake" {
return ErrBadStatus
}
upgrade, found := resp.Header["Upgrade"];
upgrade, found := resp.Header["Upgrade"]
if !found {
return ErrNoUpgrade
}
if upgrade != "WebSocket" {
return ErrBadUpgrade
}
connection, found := resp.Header["Connection"];
connection, found := resp.Header["Connection"]
if !found || connection != "Upgrade" {
return ErrBadUpgrade
}
ws_origin, found := resp.Header["Websocket-Origin"];
ws_origin, found := resp.Header["Websocket-Origin"]
if !found {
return ErrNoWebSocketOrigin
}
if ws_origin != origin {
return ErrBadWebSocketOrigin
}
ws_location, found := resp.Header["Websocket-Location"];
ws_location, found := resp.Header["Websocket-Location"]
if !found {
return ErrNoWebSocketLocation
}
@ -124,7 +124,7 @@ func handshake(resourceName, host, origin, location, protocol string, br *bufio.
return ErrBadWebSocketLocation
}
if protocol != "" {
ws_protocol, found := resp.Header["Websocket-Protocol"];
ws_protocol, found := resp.Header["Websocket-Protocol"]
if !found {
return ErrNoWebSocketProtocol
}
@ -132,5 +132,5 @@ func handshake(resourceName, host, origin, location, protocol string, br *bufio.
return ErrBadWebSocketProtocol
}
}
return;
return
}

40
src/pkg/websocket/server.go
View file

@ -5,8 +5,8 @@
package websocket
import (
"http";
"io";
"http"
"io"
)
// Handler is a interface that use a WebSocket.
@ -39,35 +39,35 @@ func (f Handler) ServeHTTP(c *http.Conn, req *http.Request) {
if req.Method != "GET" || req.Proto != "HTTP/1.1" ||
req.Header["Upgrade"] != "WebSocket" ||
req.Header["Connection"] != "Upgrade" {
c.WriteHeader(http.StatusNotFound);
io.WriteString(c, "must use websocket to connect here");
return;
c.WriteHeader(http.StatusNotFound)
io.WriteString(c, "must use websocket to connect here")
return
}
rwc, buf, err := c.Hijack();
rwc, buf, err := c.Hijack()
if err != nil {
panic("Hijack failed: ", err.String());
return;
panic("Hijack failed: ", err.String())
return
}
defer rwc.Close();
origin := req.Header["Origin"];
location := "ws://" + req.Host + req.URL.Path;
defer rwc.Close()
origin := req.Header["Origin"]
location := "ws://" + req.Host + req.URL.Path
// TODO(ukai): verify origin,location,protocol.
buf.WriteString("HTTP/1.1 101 Web Socket Protocol Handshake\r\n");
buf.WriteString("Upgrade: WebSocket\r\n");
buf.WriteString("Connection: Upgrade\r\n");
buf.WriteString("WebSocket-Origin: " + origin + "\r\n");
buf.WriteString("WebSocket-Location: " + location + "\r\n");
protocol := "";
buf.WriteString("HTTP/1.1 101 Web Socket Protocol Handshake\r\n")
buf.WriteString("Upgrade: WebSocket\r\n")
buf.WriteString("Connection: Upgrade\r\n")
buf.WriteString("WebSocket-Origin: " + origin + "\r\n")
buf.WriteString("WebSocket-Location: " + location + "\r\n")
protocol := ""
// canonical header key of WebSocket-Protocol.
if protocol, found := req.Header["Websocket-Protocol"]; found {
buf.WriteString("WebSocket-Protocol: " + protocol + "\r\n")
}
buf.WriteString("\r\n");
buf.WriteString("\r\n")
if err := buf.Flush(); err != nil {
return
}
ws := newConn(origin, location, protocol, buf, rwc);
f(ws);
ws := newConn(origin, location, protocol, buf, rwc)
f(ws)
}

74
src/pkg/websocket/websocket.go
View file

@ -12,52 +12,52 @@ package websocket
// better logging.
import (
"bufio";
"io";
"net";
"os";
"bufio"
"io"
"net"
"os"
)
type WebSocketAddr string
func (addr WebSocketAddr) Network() string { return "websocket" }
func (addr WebSocketAddr) Network() string { return "websocket" }
func (addr WebSocketAddr) String() string { return string(addr) }
func (addr WebSocketAddr) String() string { return string(addr) }
// Conn is an channels to communicate over Web Socket.
type Conn struct {
// An origin URI of the Web Socket.
Origin string;
Origin string
// A location URI of the Web Socket.
Location string;
Location string
// A subprotocol of the Web Socket.
Protocol string;
Protocol string
buf *bufio.ReadWriter;
rwc io.ReadWriteCloser;
buf *bufio.ReadWriter
rwc io.ReadWriteCloser
}
// newConn creates a new Web Socket.
func newConn(origin, location, protocol string, buf *bufio.ReadWriter, rwc io.ReadWriteCloser) *Conn {
if buf == nil {
br := bufio.NewReader(rwc);
bw := bufio.NewWriter(rwc);
buf = bufio.NewReadWriter(br, bw);
br := bufio.NewReader(rwc)
bw := bufio.NewWriter(rwc)
buf = bufio.NewReadWriter(br, bw)
}
ws := &Conn{origin, location, protocol, buf, rwc};
return ws;
ws := &Conn{origin, location, protocol, buf, rwc}
return ws
}
func (ws *Conn) Read(msg []byte) (n int, err os.Error) {
for {
frameByte, err := ws.buf.ReadByte();
frameByte, err := ws.buf.ReadByte()
if err != nil {
return n, err
}
if (frameByte & 0x80) == 0x80 {
length := 0;
length := 0
for {
c, err := ws.buf.ReadByte();
c, err := ws.buf.ReadByte()
if err != nil {
return n, err
}
@ -68,15 +68,15 @@ func (ws *Conn) Read(msg []byte) (n int, err os.Error) {
}
}
for length > 0 {
_, err := ws.buf.ReadByte();
_, err := ws.buf.ReadByte()
if err != nil {
return n, err
}
length--;
length--
}
} else {
for {
c, err := ws.buf.ReadByte();
c, err := ws.buf.ReadByte()
if err != nil {
return n, err
}
@ -87,8 +87,8 @@ func (ws *Conn) Read(msg []byte) (n int, err os.Error) {
if n+1 <= cap(msg) {
msg = msg[0 : n+1]
}
msg[n] = c;
n++;
msg[n] = c
n++
}
if n >= cap(msg) {
return n, os.E2BIG
@ -97,42 +97,42 @@ func (ws *Conn) Read(msg []byte) (n int, err os.Error) {
}
}
panic("unreachable");
panic("unreachable")
}
func (ws *Conn) Write(msg []byte) (n int, err os.Error) {
ws.buf.WriteByte(0);
ws.buf.Write(msg);
ws.buf.WriteByte(0xff);
err = ws.buf.Flush();
return len(msg), err;
ws.buf.WriteByte(0)
ws.buf.Write(msg)
ws.buf.WriteByte(0xff)
err = ws.buf.Flush()
return len(msg), err
}
func (ws *Conn) Close() os.Error { return ws.rwc.Close() }
func (ws *Conn) Close() os.Error { return ws.rwc.Close() }
func (ws *Conn) LocalAddr() net.Addr { return WebSocketAddr(ws.Origin) }
func (ws *Conn) LocalAddr() net.Addr { return WebSocketAddr(ws.Origin) }
func (ws *Conn) RemoteAddr() net.Addr { return WebSocketAddr(ws.Location) }
func (ws *Conn) RemoteAddr() net.Addr { return WebSocketAddr(ws.Location) }
func (ws *Conn) SetTimeout(nsec int64) os.Error {
if conn, ok := ws.rwc.(net.Conn); ok {
return conn.SetTimeout(nsec)
}
return os.EINVAL;
return os.EINVAL
}
func (ws *Conn) SetReadTimeout(nsec int64) os.Error {
if conn, ok := ws.rwc.(net.Conn); ok {
return conn.SetReadTimeout(nsec)
}
return os.EINVAL;
return os.EINVAL
}
func (ws *Conn) SetWriteTimeout(nsec int64) os.Error {
if conn, ok := ws.rwc.(net.Conn); ok {
return conn.SetWriteTimeout(nsec)
}
return os.EINVAL;
return os.EINVAL
}
var _ net.Conn = (*Conn)(nil) // compile-time check that *Conn implements net.Conn.
var _ net.Conn = (*Conn)(nil) // compile-time check that *Conn implements net.Conn.

48
src/pkg/websocket/websocket_test.go
View file

@ -5,57 +5,57 @@
package websocket
import (
"bytes";
"http";
"io";
"log";
"net";
"once";
"strings";
"testing";
"bytes"
"http"
"io"
"log"
"net"
"once"
"strings"
"testing"
)
var serverAddr string
func echoServer(ws *Conn) { io.Copy(ws, ws) }
func echoServer(ws *Conn) { io.Copy(ws, ws) }
func startServer() {
l, e := net.Listen("tcp", ":0"); // any available address
l, e := net.Listen("tcp", ":0") // any available address
if e != nil {
log.Exitf("net.Listen tcp :0 %v", e)
}
serverAddr = l.Addr().String();
log.Stderr("Test WebSocket server listening on ", serverAddr);
http.Handle("/echo", Handler(echoServer));
go http.Serve(l, nil);
serverAddr = l.Addr().String()
log.Stderr("Test WebSocket server listening on ", serverAddr)
http.Handle("/echo", Handler(echoServer))
go http.Serve(l, nil)
}
func TestEcho(t *testing.T) {
once.Do(startServer);
once.Do(startServer)
client, err := net.Dial("tcp", "", serverAddr);
client, err := net.Dial("tcp", "", serverAddr)
if err != nil {
t.Fatal("dialing", err)
}
ws, err := newClient("/echo", "localhost", "http://localhost",
"ws://localhost/echo", "", client);
"ws://localhost/echo", "", client)
if err != nil {
t.Errorf("WebSocket handshake error", err);
return;
t.Errorf("WebSocket handshake error", err)
return
}
msg := strings.Bytes("hello, world\n");
msg := strings.Bytes("hello, world\n")
if _, err := ws.Write(msg); err != nil {
t.Errorf("Write: error %v", err)
}
var actual_msg = make([]byte, 512);
n, err := ws.Read(actual_msg);
var actual_msg = make([]byte, 512)
n, err := ws.Read(actual_msg)
if err != nil {
t.Errorf("Read: error %v", err)
}
actual_msg = actual_msg[0:n];
actual_msg = actual_msg[0:n]
if !bytes.Equal(msg, actual_msg) {
t.Errorf("Echo: expected %q got %q", msg, actual_msg)
}
ws.Close();
ws.Close()
}

64
src/pkg/xgb/example.go
View file

@ -5,63 +5,63 @@
package main
import (
"fmt";
"os";
"xgb";
"fmt"
"os"
"xgb"
)
func main() {
c, err := xgb.Dial(os.Getenv("DISPLAY"));
c, err := xgb.Dial(os.Getenv("DISPLAY"))
if err != nil {
fmt.Printf("cannot connect: %v\n", err);
os.Exit(1);
fmt.Printf("cannot connect: %v\n", err)
os.Exit(1)
}
fmt.Printf("vendor = '%s'\n", string(c.Setup.Vendor));
fmt.Printf("vendor = '%s'\n", string(c.Setup.Vendor))
win := c.NewId();
gc := c.NewId();
win := c.NewId()
gc := c.NewId()
c.CreateWindow(0, win, c.DefaultScreen().Root, 150, 150, 200, 200, 0, 0, 0, 0, nil);
c.CreateWindow(0, win, c.DefaultScreen().Root, 150, 150, 200, 200, 0, 0, 0, 0, nil)
c.ChangeWindowAttributes(win, xgb.CWEventMask,
[]uint32{xgb.EventMaskExposure | xgb.EventMaskKeyRelease});
c.CreateGC(gc, win, 0, nil);
c.MapWindow(win);
[]uint32{xgb.EventMaskExposure | xgb.EventMaskKeyRelease})
c.CreateGC(gc, win, 0, nil)
c.MapWindow(win)
atom, _ := c.InternAtom(0, "HELLO");
fmt.Printf("atom = %d\n", atom.Atom);
atom, _ := c.InternAtom(0, "HELLO")
fmt.Printf("atom = %d\n", atom.Atom)
points := make([]xgb.Point, 2);
points[1] = xgb.Point{5, 5};
points[1] = xgb.Point{100, 120};
points := make([]xgb.Point, 2)
points[1] = xgb.Point{5, 5}
points[1] = xgb.Point{100, 120}
hosts, _ := c.ListHosts();
fmt.Printf("hosts = %+v\n", hosts);
hosts, _ := c.ListHosts()
fmt.Printf("hosts = %+v\n", hosts)
ecookie := c.ListExtensionsRequest();
exts, _ := c.ListExtensionsReply(ecookie);
ecookie := c.ListExtensionsRequest()
exts, _ := c.ListExtensionsReply(ecookie)
for _, name := range exts.Names {
fmt.Printf("exts = '%s'\n", name.Name)
}
for {
reply, err := c.WaitForEvent();
reply, err := c.WaitForEvent()
if err != nil {
fmt.Printf("error: %v\n", err);
os.Exit(1);
fmt.Printf("error: %v\n", err)
os.Exit(1)
}
fmt.Printf("event %T\n", reply);
fmt.Printf("event %T\n", reply)
switch event := reply.(type) {
case xgb.ExposeEvent:
c.PolyLine(xgb.CoordModeOrigin, win, gc, points)
case xgb.KeyReleaseEvent:
fmt.Printf("key release!\n");
points[0].X = event.EventX;
points[0].Y = event.EventY;
c.PolyLine(xgb.CoordModeOrigin, win, gc, points);
c.Bell(75);
fmt.Printf("key release!\n")
points[0].X = event.EventX
points[0].Y = event.EventY
c.PolyLine(xgb.CoordModeOrigin, win, gc, points)
c.Bell(75)
}
}
c.Close();
c.Close()
}

280
src/pkg/xgb/xgb.go
View file

@ -7,26 +7,26 @@
package xgb
import (
"fmt";
"io";
"net";
"os";
"strconv";
"strings";
"fmt"
"io"
"net"
"os"
"strconv"
"strings"
)
// A Conn represents a connection to an X server.
// Only one goroutine should use a Conn's methods at a time.
type Conn struct {
conn net.Conn;
nextId Id;
nextCookie Cookie;
replies map[Cookie][]byte;
events queue;
err os.Error;
defaultScreen int;
scratch [32]byte;
Setup SetupInfo;
conn net.Conn
nextId Id
nextCookie Cookie
replies map[Cookie][]byte
events queue
err os.Error
defaultScreen int
scratch [32]byte
Setup SetupInfo
}
// Id is used for all X identifiers, such as windows, pixmaps, and GCs.
@ -44,11 +44,11 @@ type Event interface{}
// Error contains protocol errors returned to us by the X server.
type Error struct {
Detail uint8;
Major uint8;
Minor uint16;
Cookie Cookie;
Id Id;
Detail uint8
Major uint8
Minor uint16
Cookie Cookie
Id Id
}
func (e *Error) String() string {
@ -58,81 +58,81 @@ func (e *Error) String() string {
// NewID generates a new unused ID for use with requests like CreateWindow.
func (c *Conn) NewId() Id {
id := c.nextId;
id := c.nextId
// TODO: handle ID overflow
c.nextId++;
return id;
c.nextId++
return id
}
// Pad a length to align on 4 bytes.
func pad(n int) int { return (n + 3) & ^3 }
func pad(n int) int { return (n + 3) & ^3 }
func put16(buf []byte, v uint16) {
buf[0] = byte(v);
buf[1] = byte(v >> 8);
buf[0] = byte(v)
buf[1] = byte(v >> 8)
}
func put32(buf []byte, v uint32) {
buf[0] = byte(v);
buf[1] = byte(v >> 8);
buf[2] = byte(v >> 16);
buf[3] = byte(v >> 24);
buf[0] = byte(v)
buf[1] = byte(v >> 8)
buf[2] = byte(v >> 16)
buf[3] = byte(v >> 24)
}
func get16(buf []byte) uint16 {
v := uint16(buf[0]);
v |= uint16(buf[1]) << 8;
return v;
v := uint16(buf[0])
v |= uint16(buf[1]) << 8
return v
}
func get32(buf []byte) uint32 {
v := uint32(buf[0]);
v |= uint32(buf[1]) << 8;
v |= uint32(buf[2]) << 16;
v |= uint32(buf[3]) << 32;
return v;
v := uint32(buf[0])
v |= uint32(buf[1]) << 8
v |= uint32(buf[2]) << 16
v |= uint32(buf[3]) << 32
return v
}
// Voodoo to count the number of bits set in a value list mask.
func popCount(mask0 int) int {
mask := uint32(mask0);
n := 0;
mask := uint32(mask0)
n := 0
for i := uint32(0); i < 32; i++ {
if mask&(1<<i) != 0 {
n++
}
}
return n;
return n
}
// A simple queue used to stow away events.
type queue struct {
data [][]byte;
a, b int;
data [][]byte
a, b int
}
func (q *queue) queue(item []byte) {
if q.b == len(q.data) {
if q.a > 0 {
copy(q.data, q.data[q.a:q.b]);
q.a, q.b = 0, q.b-q.a;
copy(q.data, q.data[q.a:q.b])
q.a, q.b = 0, q.b-q.a
} else {
newData := make([][]byte, (len(q.data)*3)/2);
copy(newData, q.data);
q.data = newData;
newData := make([][]byte, (len(q.data)*3)/2)
copy(newData, q.data)
q.data = newData
}
}
q.data[q.b] = item;
q.b++;
q.data[q.b] = item
q.b++
}
func (q *queue) dequeue() []byte {
if q.a < q.b {
item := q.data[q.a];
q.a++;
return item;
item := q.data[q.a]
q.a++
return item
}
return nil;
return nil
}
// sendRequest sends a request to the server and return its associated sequence number, or cookie.
@ -140,23 +140,23 @@ func (q *queue) dequeue() []byte {
// to send any additional variable length data.
func (c *Conn) sendRequest(buf []byte) Cookie {
if _, err := c.conn.Write(buf); err != nil {
fmt.Fprintf(os.Stderr, "x protocol write error: %s\n", err);
c.err = err;
fmt.Fprintf(os.Stderr, "x protocol write error: %s\n", err)
c.err = err
}
cookie := c.nextCookie;
c.nextCookie++;
return cookie;
cookie := c.nextCookie
c.nextCookie++
return cookie
}
// sendPadding sends enough bytes to align to a 4-byte border.
// It is used to pad the variable length data that is used with some requests.
func (c *Conn) sendPadding(n int) {
x := pad(n) - n;
x := pad(n) - n
if x > 0 {
_, err := c.conn.Write(c.scratch[0:x]);
_, err := c.conn.Write(c.scratch[0:x])
if err != nil {
fmt.Fprintf(os.Stderr, "x protocol write error: %s\n", err);
c.err = err;
fmt.Fprintf(os.Stderr, "x protocol write error: %s\n", err)
c.err = err
}
}
}
@ -165,37 +165,37 @@ func (c *Conn) sendPadding(n int) {
// along with any necessary padding.
func (c *Conn) sendBytes(buf []byte) {
if _, err := c.conn.Write(buf); err != nil {
fmt.Fprintf(os.Stderr, "x protocol write error: %s\n", err);
c.err = err;
fmt.Fprintf(os.Stderr, "x protocol write error: %s\n", err)
c.err = err
}
c.sendPadding(len(buf));
c.sendPadding(len(buf))
}
func (c *Conn) sendString(str string) { c.sendBytes(strings.Bytes(str)) }
func (c *Conn) sendString(str string) { c.sendBytes(strings.Bytes(str)) }
// sendUInt32s sends a list of 32-bit integers as variable length data.
func (c *Conn) sendUInt32List(list []uint32) {
buf := make([]byte, len(list)*4);
buf := make([]byte, len(list)*4)
for i := 0; i < len(list); i++ {
put32(buf[i*4:], list[i])
}
c.sendBytes(buf);
c.sendBytes(buf)
}
func (c *Conn) sendIdList(list []Id, length int) {
buf := make([]byte, length*4);
buf := make([]byte, length*4)
for i := 0; i < length; i++ {
put32(buf[i*4:], uint32(list[i]))
}
c.sendBytes(buf);
c.sendBytes(buf)
}
func (c *Conn) sendKeysymList(list []Keysym, length int) {
buf := make([]byte, length*4);
buf := make([]byte, length*4)
for i := 0; i < length; i++ {
put32(buf[i*4:], uint32(list[i]))
}
c.sendBytes(buf);
c.sendBytes(buf)
}
// readNextReply reads and processes the next server reply.
@ -203,10 +203,10 @@ func (c *Conn) sendKeysymList(list []Keysym, length int) {
// Events are pushed onto the event queue and replies to requests
// are stashed away in a map indexed by the sequence number.
func (c *Conn) readNextReply() os.Error {
buf := make([]byte, 32);
buf := make([]byte, 32)
if _, err := io.ReadFull(c.conn, buf); err != nil {
fmt.Fprintf(os.Stderr, "x protocol read error: %s\n", err);
return err;
fmt.Fprintf(os.Stderr, "x protocol read error: %s\n", err)
return err
}
switch buf[0] {
@ -217,21 +217,21 @@ func (c *Conn) readNextReply() os.Error {
Id: Id(get32(buf[4:])),
Minor: get16(buf[8:]),
Major: buf[10],
};
fmt.Fprintf(os.Stderr, "x protocol error: %s\n", err);
return err;
}
fmt.Fprintf(os.Stderr, "x protocol error: %s\n", err)
return err
case 1:
seq := Cookie(get16(buf[2:]));
size := get32(buf[4:]);
seq := Cookie(get16(buf[2:]))
size := get32(buf[4:])
if size > 0 {
bigbuf := make([]byte, 32+size*4, 32+size*4);
copy(bigbuf[0:32], buf);
bigbuf := make([]byte, 32+size*4, 32+size*4)
copy(bigbuf[0:32], buf)
if _, err := io.ReadFull(c.conn, bigbuf[32:]); err != nil {
fmt.Fprintf(os.Stderr, "x protocol read error: %s\n", err);
return err;
fmt.Fprintf(os.Stderr, "x protocol read error: %s\n", err)
return err
}
c.replies[seq] = bigbuf;
c.replies[seq] = bigbuf
} else {
c.replies[seq] = buf
}
@ -240,7 +240,7 @@ func (c *Conn) readNextReply() os.Error {
c.events.queue(buf)
}
return nil;
return nil
}
// waitForReply looks for a reply in the map indexed by sequence number.
@ -249,14 +249,14 @@ func (c *Conn) readNextReply() os.Error {
func (c *Conn) waitForReply(cookie Cookie) ([]byte, os.Error) {
for {
if reply, ok := c.replies[cookie]; ok {
c.replies[cookie] = reply, false;
return reply, nil;
c.replies[cookie] = reply, false
return reply, nil
}
if err := c.readNextReply(); err != nil {
return nil, err
}
}
panic("unreachable");
panic("unreachable")
}
// WaitForEvent returns the next event from the server.
@ -270,7 +270,7 @@ func (c *Conn) WaitForEvent() (Event, os.Error) {
return nil, err
}
}
panic("unreachable");
panic("unreachable")
}
// PollForEvent returns the next event from the server if one is available in the internal queue.
@ -280,119 +280,119 @@ func (c *Conn) PollForEvent() (Event, os.Error) {
if reply := c.events.dequeue(); reply != nil {
return parseEvent(reply)
}
return nil, nil;
return nil, nil
}
// Dial connects to the X server given in the 'display' string.
// The display string is typically taken from os.Getenv("DISPLAY").
func Dial(display string) (*Conn, os.Error) {
var err os.Error;
var err os.Error
c := new(Conn);
c := new(Conn)
if display[0] == '/' {
c.conn, err = net.Dial("unix", "", display);
c.conn, err = net.Dial("unix", "", display)
if err != nil {
fmt.Printf("cannot connect: %v\n", err);
return nil, err;
fmt.Printf("cannot connect: %v\n", err)
return nil, err
}
} else {
parts := strings.Split(display, ":", 2);
host := parts[0];
port := 0;
parts := strings.Split(display, ":", 2)
host := parts[0]
port := 0
if len(parts) > 1 {
parts = strings.Split(parts[1], ".", 2);
port, _ = strconv.Atoi(parts[0]);
parts = strings.Split(parts[1], ".", 2)
port, _ = strconv.Atoi(parts[0])
if len(parts) > 1 {
c.defaultScreen, _ = strconv.Atoi(parts[1])
}
}
display = fmt.Sprintf("%s:%d", host, port+6000);
c.conn, err = net.Dial("tcp", "", display);
display = fmt.Sprintf("%s:%d", host, port+6000)
c.conn, err = net.Dial("tcp", "", display)
if err != nil {
fmt.Printf("cannot connect: %v\n", err);
return nil, err;
fmt.Printf("cannot connect: %v\n", err)
return nil, err
}
}
// TODO: get these from .Xauthority
var authName, authData []byte;
var authName, authData []byte
buf := make([]byte, 12+pad(len(authName))+pad(len(authData)));
buf[0] = 'l';
buf[1] = 0;
put16(buf[2:], 11);
put16(buf[4:], 0);
put16(buf[6:], uint16(len(authName)));
put16(buf[8:], uint16(len(authData)));
put16(buf[10:], 0);
copy(buf[12:], authName);
copy(buf[12+pad(len(authName)):], authData);
buf := make([]byte, 12+pad(len(authName))+pad(len(authData)))
buf[0] = 'l'
buf[1] = 0
put16(buf[2:], 11)
put16(buf[4:], 0)
put16(buf[6:], uint16(len(authName)))
put16(buf[8:], uint16(len(authData)))
put16(buf[10:], 0)
copy(buf[12:], authName)
copy(buf[12+pad(len(authName)):], authData)
if _, err = c.conn.Write(buf); err != nil {
return nil, err
}
head := make([]byte, 8);
head := make([]byte, 8)
if _, err = io.ReadFull(c.conn, head[0:8]); err != nil {
return nil, err
}
code := head[0];
reasonLen := head[1];
major := get16(head[2:]);
minor := get16(head[4:]);
dataLen := get16(head[6:]);
code := head[0]
reasonLen := head[1]
major := get16(head[2:])
minor := get16(head[4:])
dataLen := get16(head[6:])
if major != 11 || minor != 0 {
return nil, os.NewError(fmt.Sprintf("x protocol version mismatch: %d.%d", major, minor))
}
buf = make([]byte, int(dataLen)*4+8, int(dataLen)*4+8);
copy(buf, head);
buf = make([]byte, int(dataLen)*4+8, int(dataLen)*4+8)
copy(buf, head)
if _, err = io.ReadFull(c.conn, buf[8:]); err != nil {
return nil, err
}
if code == 0 {
reason := buf[8 : 8+reasonLen];
return nil, os.NewError(fmt.Sprintf("x protocol authentication refused: %s", string(reason)));
reason := buf[8 : 8+reasonLen]
return nil, os.NewError(fmt.Sprintf("x protocol authentication refused: %s", string(reason)))
}
getSetupInfo(buf, &c.Setup);
getSetupInfo(buf, &c.Setup)
if c.defaultScreen >= len(c.Setup.Roots) {
c.defaultScreen = 0
}
c.nextId = Id(c.Setup.ResourceIdBase);
c.nextCookie = 1;
c.replies = make(map[Cookie][]byte);
c.events = queue{make([][]byte, 100), 0, 0};
return c, nil;
c.nextId = Id(c.Setup.ResourceIdBase)
c.nextCookie = 1
c.replies = make(map[Cookie][]byte)
c.events = queue{make([][]byte, 100), 0, 0}
return c, nil
}
// Close closes the connection to the X server.
func (c *Conn) Close() { c.conn.Close() }
func (c *Conn) Close() { c.conn.Close() }
// DefaultScreen returns the Screen info for the default screen, which is
// 0 or the one given in the display argument to Dial.
func (c *Conn) DefaultScreen() *ScreenInfo { return &c.Setup.Roots[c.defaultScreen] }
func (c *Conn) DefaultScreen() *ScreenInfo { return &c.Setup.Roots[c.defaultScreen] }
// ClientMessageData holds the data from a client message,
// duplicated in three forms because Go doesn't have unions.
type ClientMessageData struct {
Data8 [20]byte;
Data16 [10]uint16;
Data32 [5]uint32;
Data8 [20]byte
Data16 [10]uint16
Data32 [5]uint32
}
func getClientMessageData(b []byte, v *ClientMessageData) int {
copy(&v.Data8, b);
copy(&v.Data8, b)
for i := 0; i < 10; i++ {
v.Data16[i] = get16(b[i*2:])
}
for i := 0; i < 5; i++ {
v.Data32[i] = get32(b[i*4:])
}
return 20;
return 20
}

4912
src/pkg/xgb/xproto.go
View file

File diff suppressed because it is too large Load diff

134
src/pkg/xml/read.go
View file

@ -5,12 +5,12 @@
package xml
import (
"bytes";
"io";
"os";
"reflect";
"strings";
"unicode";
"bytes"
"io"
"os"
"reflect"
"strings"
"unicode"
)
// BUG(rsc): Mapping between XML elements and data structures is inherently flawed:
@ -113,23 +113,23 @@ import (
// to a freshly allocated value and then mapping the element to that value.
//
func Unmarshal(r io.Reader, val interface{}) os.Error {
v, ok := reflect.NewValue(val).(*reflect.PtrValue);
v, ok := reflect.NewValue(val).(*reflect.PtrValue)
if !ok {
return os.NewError("non-pointer passed to Unmarshal")
}
p := NewParser(r);
elem := v.Elem();
err := p.unmarshal(elem, nil);
p := NewParser(r)
elem := v.Elem()
err := p.unmarshal(elem, nil)
if err != nil {
return err
}
return nil;
return nil
}
// An UnmarshalError represents an error in the unmarshalling process.
type UnmarshalError string
func (e UnmarshalError) String() string { return string(e) }
func (e UnmarshalError) String() string { return string(e) }
// The Parser's Unmarshal method is like xml.Unmarshal
// except that it can be passed a pointer to the initial start element,
@ -138,11 +138,11 @@ func (e UnmarshalError) String() string { return string(e) }
// Passing a nil start element indicates that Unmarshal should
// read the token stream to find the start element.
func (p *Parser) Unmarshal(val interface{}, start *StartElement) os.Error {
v, ok := reflect.NewValue(val).(*reflect.PtrValue);
v, ok := reflect.NewValue(val).(*reflect.PtrValue)
if !ok {
return os.NewError("non-pointer passed to Unmarshal")
}
return p.unmarshal(v.Elem(), start);
return p.unmarshal(v.Elem(), start)
}
// fieldName strips invalid characters from an XML name
@ -154,7 +154,7 @@ func fieldName(original string) string {
if unicode.IsDigit(x) || unicode.IsLetter(x) {
return unicode.ToLower(x)
}
return -1;
return -1
},
original)
}
@ -164,87 +164,87 @@ func (p *Parser) unmarshal(val reflect.Value, start *StartElement) os.Error {
// Find start element if we need it.
if start == nil {
for {
tok, err := p.Token();
tok, err := p.Token()
if err != nil {
return err
}
if t, ok := tok.(StartElement); ok {
start = &t;
break;
start = &t
break
}
}
}
if pv, ok := val.(*reflect.PtrValue); ok {
if pv.Get() == 0 {
zv := reflect.MakeZero(pv.Type().(*reflect.PtrType).Elem());
pv.PointTo(zv);
val = zv;
zv := reflect.MakeZero(pv.Type().(*reflect.PtrType).Elem())
pv.PointTo(zv)
val = zv
} else {
val = pv.Elem()
}
}
var (
data []byte;
saveData reflect.Value;
comment []byte;
saveComment reflect.Value;
sv *reflect.StructValue;
styp *reflect.StructType;
data []byte
saveData reflect.Value
comment []byte
saveComment reflect.Value
sv *reflect.StructValue
styp *reflect.StructType
)
switch v := val.(type) {
case *reflect.BoolValue:
v.Set(true)
case *reflect.SliceValue:
typ := v.Type().(*reflect.SliceType);
typ := v.Type().(*reflect.SliceType)
if _, ok := typ.Elem().(*reflect.Uint8Type); ok {
// []byte
saveData = v;
break;
saveData = v
break
}
// Slice of element values.
// Grow slice.
n := v.Len();
n := v.Len()
if n >= v.Cap() {
ncap := 2 * n;
ncap := 2 * n
if ncap < 4 {
ncap = 4
}
new := reflect.MakeSlice(typ, n, ncap);
reflect.ArrayCopy(new, v);
v.Set(new);
new := reflect.MakeSlice(typ, n, ncap)
reflect.ArrayCopy(new, v)
v.Set(new)
}
v.SetLen(n + 1);
v.SetLen(n + 1)
// Recur to read element into slice.
if err := p.unmarshal(v.Elem(n), start); err != nil {
v.SetLen(n);
return err;
v.SetLen(n)
return err
}
return nil;
return nil
case *reflect.StringValue:
saveData = v
case *reflect.StructValue:
if _, ok := v.Interface().(Name); ok {
v.Set(reflect.NewValue(start.Name).(*reflect.StructValue));
break;
v.Set(reflect.NewValue(start.Name).(*reflect.StructValue))
break
}
sv = v;
typ := sv.Type().(*reflect.StructType);
styp = typ;
sv = v
typ := sv.Type().(*reflect.StructType)
styp = typ
// Assign name.
if f, ok := typ.FieldByName("XMLName"); ok {
// Validate element name.
if f.Tag != "" {
tag := f.Tag;
ns := "";
i := strings.LastIndex(tag, " ");
tag := f.Tag
ns := ""
i := strings.LastIndex(tag, " ")
if i >= 0 {
ns, tag = tag[0:i], tag[i+1:]
}
@ -252,44 +252,44 @@ func (p *Parser) unmarshal(val reflect.Value, start *StartElement) os.Error {
return UnmarshalError("expected element type <" + tag + "> but have <" + start.Name.Local + ">")
}
if ns != "" && ns != start.Name.Space {
e := "expected element <" + tag + "> in name space " + ns + " but have ";
e := "expected element <" + tag + "> in name space " + ns + " but have "
if start.Name.Space == "" {
e += "no name space"
} else {
e += start.Name.Space
}
return UnmarshalError(e);
return UnmarshalError(e)
}
}
// Save
v := sv.FieldByIndex(f.Index);
v := sv.FieldByIndex(f.Index)
if _, ok := v.Interface().(Name); !ok {
return UnmarshalError(sv.Type().String() + " field XMLName does not have type xml.Name")
}
v.(*reflect.StructValue).Set(reflect.NewValue(start.Name).(*reflect.StructValue));
v.(*reflect.StructValue).Set(reflect.NewValue(start.Name).(*reflect.StructValue))
}
// Assign attributes.
// Also, determine whether we need to save character data or comments.
for i, n := 0, typ.NumField(); i < n; i++ {
f := typ.Field(i);
f := typ.Field(i)
switch f.Tag {
case "attr":
strv, ok := sv.FieldByIndex(f.Index).(*reflect.StringValue);
strv, ok := sv.FieldByIndex(f.Index).(*reflect.StringValue)
if !ok {
return UnmarshalError(sv.Type().String() + " field " + f.Name + " has attr tag but is not type string")
}
// Look for attribute.
val := "";
k := strings.ToLower(f.Name);
val := ""
k := strings.ToLower(f.Name)
for _, a := range start.Attr {
if fieldName(a.Name.Local) == k {
val = a.Value;
break;
val = a.Value
break
}
}
strv.Set(val);
strv.Set(val)
case "comment":
if saveComment == nil {
@ -308,7 +308,7 @@ func (p *Parser) unmarshal(val reflect.Value, start *StartElement) os.Error {
// Process sub-elements along the way.
Loop:
for {
tok, err := p.Token();
tok, err := p.Token()
if err != nil {
return err
}
@ -318,15 +318,15 @@ Loop:
// Look up by tag name.
// If that fails, fall back to mop-up field named "Any".
if sv != nil {
k := fieldName(t.Name.Local);
any := -1;
k := fieldName(t.Name.Local)
any := -1
for i, n := 0, styp.NumField(); i < n; i++ {
f := styp.Field(i);
f := styp.Field(i)
if strings.ToLower(f.Name) == k {
if err := p.unmarshal(sv.FieldByIndex(f.Index), &t); err != nil {
return err
}
continue Loop;
continue Loop
}
if any < 0 && f.Name == "Any" {
any = i
@ -336,7 +336,7 @@ Loop:
if err := p.unmarshal(sv.FieldByIndex(styp.Field(any).Index), &t); err != nil {
return err
}
continue Loop;
continue Loop
}
}
// Not saving sub-element but still have to skip over it.
@ -374,7 +374,7 @@ Loop:
t.Set(reflect.NewValue(comment).(*reflect.SliceValue))
}
return nil;
return nil
}
// Have already read a start element.
@ -383,7 +383,7 @@ Loop:
// end element matches the start element we saw.
func (p *Parser) Skip() os.Error {
for {
tok, err := p.Token();
tok, err := p.Token()
if err != nil {
return err
}
@ -396,5 +396,5 @@ func (p *Parser) Skip() os.Error {
return nil
}
}
panic("unreachable");
panic("unreachable")
}

50
src/pkg/xml/read_test.go
View file

@ -5,14 +5,14 @@
package xml
import (
"reflect";
"testing";
"reflect"
"testing"
)
// Stripped down Atom feed data structures.
func TestUnmarshalFeed(t *testing.T) {
var f Feed;
var f Feed
if err := Unmarshal(StringReader(rssFeedString), &f); err != nil {
t.Fatalf("Unmarshal: %s", err)
}
@ -78,38 +78,38 @@ not being used from outside intra_region_diff.py.
</summary></entry></feed>`
type Feed struct {
XMLName Name "http://www.w3.org/2005/Atom feed";
Title string;
Id string;
Link []Link;
Updated Time;
Author Person;
Entry []Entry;
XMLName Name "http://www.w3.org/2005/Atom feed"
Title string
Id string
Link []Link
Updated Time
Author Person
Entry []Entry
}
type Entry struct {
Title string;
Id string;
Link []Link;
Updated Time;
Author Person;
Summary Text;
Title string
Id string
Link []Link
Updated Time
Author Person
Summary Text
}
type Link struct {
Rel string "attr";
Href string "attr";
Rel string "attr"
Href string "attr"
}
type Person struct {
Name string;
URI string;
Email string;
Name string
URI string
Email string
}
type Text struct {
Type string "attr";
Body string "chardata";
Type string "attr"
Body string "chardata"
}
type Time string
@ -210,7 +210,7 @@ not being used from outside intra_region_diff.py.
}
type FieldNameTest struct {
in, out string;
in, out string
}
var FieldNameTests = []FieldNameTest{
@ -220,7 +220,7 @@ var FieldNameTests = []FieldNameTest{
func TestFieldName(t *testing.T) {
for _, tt := range FieldNameTests {
a := fieldName(tt.in);
a := fieldName(tt.in)
if a != tt.out {
t.Fatalf("have %#v\nwant %#v\n\n", a, tt.out)
}

496
src/pkg/xml/xml.go
View file

@ -15,20 +15,20 @@ package xml
// Expose parser line number in errors.
import (
"bufio";
"bytes";
"io";
"os";
"strconv";
"strings";
"unicode";
"utf8";
"bufio"
"bytes"
"io"
"os"
"strconv"
"strings"
"unicode"
"utf8"
)
// A SyntaxError represents a syntax error in the XML input stream.
type SyntaxError string
func (e SyntaxError) String() string { return "XML syntax error: " + string(e) }
func (e SyntaxError) String() string { return "XML syntax error: " + string(e) }
// A Name represents an XML name (Local) annotated
// with a name space identifier (Space).
@ -36,13 +36,13 @@ func (e SyntaxError) String() string { return "XML syntax error: " + string(e) }
// is given as a canonical URL, not the short prefix used
// in the document being parsed.
type Name struct {
Space, Local string;
Space, Local string
}
// An Attr represents an attribute in an XML element (Name=Value).
type Attr struct {
Name Name;
Value string;
Name Name
Value string
}
// A Token is an interface holding one of the token types:
@ -51,13 +51,13 @@ type Token interface{}
// A StartElement represents an XML start element.
type StartElement struct {
Name Name;
Attr []Attr;
Name Name
Attr []Attr
}
// An EndElement represents an XML end element.
type EndElement struct {
Name Name;
Name Name
}
// A CharData represents XML character data (raw text),
@ -66,38 +66,38 @@ type EndElement struct {
type CharData []byte
func makeCopy(b []byte) []byte {
b1 := make([]byte, len(b));
copy(b1, b);
return b1;
b1 := make([]byte, len(b))
copy(b1, b)
return b1
}
func (c CharData) Copy() CharData { return CharData(makeCopy(c)) }
func (c CharData) Copy() CharData { return CharData(makeCopy(c)) }
// A Comment represents an XML comment of the form <!--comment-->.
// The bytes do not include the <!-- and --> comment markers.
type Comment []byte
func (c Comment) Copy() Comment { return Comment(makeCopy(c)) }
func (c Comment) Copy() Comment { return Comment(makeCopy(c)) }
// A ProcInst represents an XML processing instruction of the form <?target inst?>
type ProcInst struct {
Target string;
Inst []byte;
Target string
Inst []byte
}
func (p ProcInst) Copy() ProcInst {
p.Inst = makeCopy(p.Inst);
return p;
p.Inst = makeCopy(p.Inst)
return p
}
// A Directive represents an XML directive of the form <!text>.
// The bytes do not include the <! and > markers.
type Directive []byte
func (d Directive) Copy() Directive { return Directive(makeCopy(d)) }
func (d Directive) Copy() Directive { return Directive(makeCopy(d)) }
type readByter interface {
ReadByte() (b byte, err os.Error);
ReadByte() (b byte, err os.Error)
}
// A Parser represents an XML parser reading a particular input stream.
@ -120,12 +120,12 @@ type Parser struct {
// p.Entity = HTMLEntity
//
// creates a parser that can handle typical HTML.
Strict bool;
Strict bool
// When Strict == false, AutoClose indicates a set of elements to
// consider closed immediately after they are opened, regardless
// of whether an end element is present.
AutoClose []string;
AutoClose []string
// Entity can be used to map non-standard entity names to string replacements.
// The parser behaves as if these standard mappings are present in the map,
@ -137,20 +137,20 @@ type Parser struct {
// "pos": "'",
// "quot": `"`,
//
Entity map[string]string;
Entity map[string]string
r readByter;
buf bytes.Buffer;
stk *stack;
free *stack;
needClose bool;
toClose Name;
nextToken Token;
nextByte int;
ns map[string]string;
err os.Error;
line int;
tmp [32]byte;
r readByter
buf bytes.Buffer
stk *stack
free *stack
needClose bool
toClose Name
nextToken Token
nextByte int
ns map[string]string
err os.Error
line int
tmp [32]byte
}
// NewParser creates a new XML parser reading from r.
@ -160,7 +160,7 @@ func NewParser(r io.Reader) *Parser {
nextByte: -1,
line: 1,
Strict: true,
};
}
// Get efficient byte at a time reader.
// Assume that if reader has its own
@ -172,7 +172,7 @@ func NewParser(r io.Reader) *Parser {
p.r = bufio.NewReader(r)
}
return p;
return p
}
// Token returns the next XML token in the input stream.
@ -200,16 +200,16 @@ func NewParser(r io.Reader) *Parser {
//
func (p *Parser) Token() (t Token, err os.Error) {
if p.nextToken != nil {
t = p.nextToken;
p.nextToken = nil;
t = p.nextToken
p.nextToken = nil
} else if t, err = p.RawToken(); err != nil {
return
}
if !p.Strict {
if t1, ok := p.autoClose(t); ok {
p.nextToken = t;
t = t1;
p.nextToken = t
t = t1
}
}
switch t1 := t.(type) {
@ -220,33 +220,33 @@ func (p *Parser) Token() (t Token, err os.Error) {
// the translations first.
for _, a := range t1.Attr {
if a.Name.Space == "xmlns" {
v, ok := p.ns[a.Name.Local];
p.pushNs(a.Name.Local, v, ok);
p.ns[a.Name.Local] = a.Value;
v, ok := p.ns[a.Name.Local]
p.pushNs(a.Name.Local, v, ok)
p.ns[a.Name.Local] = a.Value
}
if a.Name.Space == "" && a.Name.Local == "xmlns" {
// Default space for untagged names
v, ok := p.ns[""];
p.pushNs("", v, ok);
p.ns[""] = a.Value;
v, ok := p.ns[""]
p.pushNs("", v, ok)
p.ns[""] = a.Value
}
}
p.translate(&t1.Name, true);
p.translate(&t1.Name, true)
for i := range t1.Attr {
p.translate(&t1.Attr[i].Name, false)
}
p.pushElement(t1.Name);
t = t1;
p.pushElement(t1.Name)
t = t1
case EndElement:
p.translate(&t1.Name, true);
p.translate(&t1.Name, true)
if !p.popElement(&t1) {
return nil, p.err
}
t = t1;
t = t1
}
return;
return
}
// Apply name space translation to name n.
@ -271,53 +271,53 @@ func (p *Parser) translate(n *Name, isElementName bool) {
// ending a given tag are *below* it on the stack, which is
// more work but forced on us by XML.
type stack struct {
next *stack;
kind int;
name Name;
ok bool;
next *stack
kind int
name Name
ok bool
}
const (
stkStart = iota;
stkNs;
stkStart = iota
stkNs
)
func (p *Parser) push(kind int) *stack {
s := p.free;
s := p.free
if s != nil {
p.free = s.next
} else {
s = new(stack)
}
s.next = p.stk;
s.kind = kind;
p.stk = s;
return s;
s.next = p.stk
s.kind = kind
p.stk = s
return s
}
func (p *Parser) pop() *stack {
s := p.stk;
s := p.stk
if s != nil {
p.stk = s.next;
s.next = p.free;
p.free = s;
p.stk = s.next
s.next = p.free
p.free = s
}
return s;
return s
}
// Record that we are starting an element with the given name.
func (p *Parser) pushElement(name Name) {
s := p.push(stkStart);
s.name = name;
s := p.push(stkStart)
s.name = name
}
// Record that we are changing the value of ns[local].
// The old value is url, ok.
func (p *Parser) pushNs(local string, url string, ok bool) {
s := p.push(stkNs);
s.name.Local = local;
s.name.Space = url;
s.ok = ok;
s := p.push(stkNs)
s.name.Local = local
s.name.Space = url
s.ok = ok
}
// Record that we are ending an element with the given name.
@ -327,35 +327,35 @@ func (p *Parser) pushNs(local string, url string, ok bool) {
// the stack to restore the name translations that existed
// before we saw this element.
func (p *Parser) popElement(t *EndElement) bool {
s := p.pop();
name := t.Name;
s := p.pop()
name := t.Name
switch {
case s == nil || s.kind != stkStart:
p.err = SyntaxError("unexpected end element </" + name.Local + ">");
return false;
p.err = SyntaxError("unexpected end element </" + name.Local + ">")
return false
case s.name.Local != name.Local:
if !p.Strict {
p.needClose = true;
p.toClose = t.Name;
t.Name = s.name;
return true;
p.needClose = true
p.toClose = t.Name
t.Name = s.name
return true
}
p.err = SyntaxError("element <" + s.name.Local + "> closed by </" + name.Local + ">");
return false;
p.err = SyntaxError("element <" + s.name.Local + "> closed by </" + name.Local + ">")
return false
case s.name.Space != name.Space:
p.err = SyntaxError("element <" + s.name.Local + "> in space " + s.name.Space +
"closed by </" + name.Local + "> in space " + name.Space);
return false;
"closed by </" + name.Local + "> in space " + name.Space)
return false
}
// Pop stack until a Start is on the top, undoing the
// translations that were associated with the element we just closed.
for p.stk != nil && p.stk.kind != stkStart {
s := p.pop();
p.ns[s.name.Local] = s.name.Space, s.ok;
s := p.pop()
p.ns[s.name.Local] = s.name.Space, s.ok
}
return true;
return true
}
// If the top element on the stack is autoclosing and
@ -364,18 +364,18 @@ func (p *Parser) autoClose(t Token) (Token, bool) {
if p.stk == nil || p.stk.kind != stkStart {
return nil, false
}
name := strings.ToLower(p.stk.name.Local);
name := strings.ToLower(p.stk.name.Local)
for _, s := range p.AutoClose {
if strings.ToLower(s) == name {
// This one should be auto closed if t doesn't close it.
et, ok := t.(EndElement);
et, ok := t.(EndElement)
if !ok || et.Name.Local != name {
return EndElement{p.stk.name}, true
}
break;
break
}
}
return nil, false;
return nil, false
}
@ -390,23 +390,23 @@ func (p *Parser) RawToken() (Token, os.Error) {
// The last element we read was self-closing and
// we returned just the StartElement half.
// Return the EndElement half now.
p.needClose = false;
return EndElement{p.toClose}, nil;
p.needClose = false
return EndElement{p.toClose}, nil
}
b, ok := p.getc();
b, ok := p.getc()
if !ok {
return nil, p.err
}
if b != '<' {
// Text section.
p.ungetc(b);
data := p.text(-1, false);
p.ungetc(b)
data := p.text(-1, false)
if data == nil {
return nil, p.err
}
return CharData(data), nil;
return CharData(data), nil
}
if b, ok = p.mustgetc(); !ok {
@ -415,50 +415,50 @@ func (p *Parser) RawToken() (Token, os.Error) {
switch b {
case '/':
// </: End element
var name Name;
var name Name
if name, ok = p.nsname(); !ok {
if p.err == nil {
p.err = SyntaxError("expected element name after </")
}
return nil, p.err;
return nil, p.err
}
p.space();
p.space()
if b, ok = p.mustgetc(); !ok {
return nil, p.err
}
if b != '>' {
p.err = SyntaxError("invalid characters between </" + name.Local + " and >");
return nil, p.err;
p.err = SyntaxError("invalid characters between </" + name.Local + " and >")
return nil, p.err
}
return EndElement{name}, nil;
return EndElement{name}, nil
case '?':
// <?: Processing instruction.
// TODO(rsc): Should parse the <?xml declaration to make sure
// the version is 1.0 and the encoding is UTF-8.
var target string;
var target string
if target, ok = p.name(); !ok {
if p.err == nil {
p.err = SyntaxError("expected target name after <?")
}
return nil, p.err;
return nil, p.err
}
p.space();
p.buf.Reset();
var b0 byte;
p.space()
p.buf.Reset()
var b0 byte
for {
if b, ok = p.mustgetc(); !ok {
return nil, p.err
}
p.buf.WriteByte(b);
p.buf.WriteByte(b)
if b0 == '?' && b == '>' {
break
}
b0 = b;
b0 = b
}
data := p.buf.Bytes();
data = data[0 : len(data)-2]; // chop ?>
return ProcInst{target, data}, nil;
data := p.buf.Bytes()
data = data[0 : len(data)-2] // chop ?>
return ProcInst{target, data}, nil
case '!':
// <!: Maybe comment, maybe CDATA.
@ -466,55 +466,55 @@ func (p *Parser) RawToken() (Token, os.Error) {
return nil, p.err
}
switch b {
case '-': // <!-
case '-': // <!-
// Probably <!-- for a comment.
if b, ok = p.mustgetc(); !ok {
return nil, p.err
}
if b != '-' {
p.err = SyntaxError("invalid sequence <!- not part of <!--");
return nil, p.err;
p.err = SyntaxError("invalid sequence <!- not part of <!--")
return nil, p.err
}
// Look for terminator.
p.buf.Reset();
var b0, b1 byte;
p.buf.Reset()
var b0, b1 byte
for {
if b, ok = p.mustgetc(); !ok {
return nil, p.err
}
p.buf.WriteByte(b);
p.buf.WriteByte(b)
if b0 == '-' && b1 == '-' && b == '>' {
break
}
b0, b1 = b1, b;
b0, b1 = b1, b
}
data := p.buf.Bytes();
data = data[0 : len(data)-3]; // chop -->
return Comment(data), nil;
data := p.buf.Bytes()
data = data[0 : len(data)-3] // chop -->
return Comment(data), nil
case '[': // <![
case '[': // <![
// Probably <![CDATA[.
for i := 0; i < 6; i++ {
if b, ok = p.mustgetc(); !ok {
return nil, p.err
}
if b != "CDATA["[i] {
p.err = SyntaxError("invalid <![ sequence");
return nil, p.err;
p.err = SyntaxError("invalid <![ sequence")
return nil, p.err
}
}
// Have <![CDATA[. Read text until ]]>.
data := p.text(-1, true);
data := p.text(-1, true)
if data == nil {
return nil, p.err
}
return CharData(data), nil;
return CharData(data), nil
}
// Probably a directive: <!DOCTYPE ...>, <!ENTITY ...>, etc.
// We don't care, but accumulate for caller.
p.buf.Reset();
p.buf.WriteByte(b);
p.buf.Reset()
p.buf.WriteByte(b)
for {
if b, ok = p.mustgetc(); !ok {
return nil, p.err
@ -522,106 +522,106 @@ func (p *Parser) RawToken() (Token, os.Error) {
if b == '>' {
break
}
p.buf.WriteByte(b);
p.buf.WriteByte(b)
}
return Directive(p.buf.Bytes()), nil;
return Directive(p.buf.Bytes()), nil
}
// Must be an open element like <a href="foo">
p.ungetc(b);
p.ungetc(b)
var (
name Name;
empty bool;
attr []Attr;
name Name
empty bool
attr []Attr
)
if name, ok = p.nsname(); !ok {
if p.err == nil {
p.err = SyntaxError("expected element name after <")
}
return nil, p.err;
return nil, p.err
}
attr = make([]Attr, 0, 4);
attr = make([]Attr, 0, 4)
for {
p.space();
p.space()
if b, ok = p.mustgetc(); !ok {
return nil, p.err
}
if b == '/' {
empty = true;
empty = true
if b, ok = p.mustgetc(); !ok {
return nil, p.err
}
if b != '>' {
p.err = SyntaxError("expected /> in element");
return nil, p.err;
p.err = SyntaxError("expected /> in element")
return nil, p.err
}
break;
break
}
if b == '>' {
break
}
p.ungetc(b);
p.ungetc(b)
n := len(attr);
n := len(attr)
if n >= cap(attr) {
nattr := make([]Attr, n, 2*cap(attr));
nattr := make([]Attr, n, 2*cap(attr))
for i, a := range attr {
nattr[i] = a
}
attr = nattr;
attr = nattr
}
attr = attr[0 : n+1];
a := &attr[n];
attr = attr[0 : n+1]
a := &attr[n]
if a.Name, ok = p.nsname(); !ok {
if p.err == nil {
p.err = SyntaxError("expected attribute name in element")
}
return nil, p.err;
return nil, p.err
}
p.space();
p.space()
if b, ok = p.mustgetc(); !ok {
return nil, p.err
}
if b != '=' {
p.err = SyntaxError("attribute name without = in element");
return nil, p.err;
p.err = SyntaxError("attribute name without = in element")
return nil, p.err
}
p.space();
p.space()
if b, ok = p.mustgetc(); !ok {
return nil, p.err
}
if b != '"' && b != '\'' {
p.err = SyntaxError("unquoted or missing attribute value in element");
return nil, p.err;
p.err = SyntaxError("unquoted or missing attribute value in element")
return nil, p.err
}
data := p.text(int(b), false);
data := p.text(int(b), false)
if data == nil {
return nil, p.err
}
a.Value = string(data);
a.Value = string(data)
}
if empty {
p.needClose = true;
p.toClose = name;
p.needClose = true
p.toClose = name
}
return StartElement{name, attr}, nil;
return StartElement{name, attr}, nil
}
// Skip spaces if any
func (p *Parser) space() {
for {
b, ok := p.getc();
b, ok := p.getc()
if !ok {
return
}
switch b {
case ' ', '\r', '\n', '\t':
default:
p.ungetc(b);
return;
p.ungetc(b)
return
}
}
}
@ -635,10 +635,10 @@ func (p *Parser) getc() (b byte, ok bool) {
return 0, false
}
if p.nextByte >= 0 {
b = byte(p.nextByte);
p.nextByte = -1;
b = byte(p.nextByte)
p.nextByte = -1
} else {
b, p.err = p.r.ReadByte();
b, p.err = p.r.ReadByte()
if p.err != nil {
return 0, false
}
@ -646,7 +646,7 @@ func (p *Parser) getc() (b byte, ok bool) {
if b == '\n' {
p.line++
}
return b, true;
return b, true
}
// Must read a single byte.
@ -659,7 +659,7 @@ func (p *Parser) mustgetc() (b byte, ok bool) {
p.err = SyntaxError("unexpected EOF")
}
}
return;
return
}
// Unread a single byte.
@ -667,7 +667,7 @@ func (p *Parser) ungetc(b byte) {
if b == '\n' {
p.line--
}
p.nextByte = int(b);
p.nextByte = int(b)
}
var entity = map[string]int{
@ -683,12 +683,12 @@ var entity = map[string]int{
// If cdata == true, we are in a <![CDATA[ section and need to find ]]>.
// On failure return nil and leave the error in p.err.
func (p *Parser) text(quote int, cdata bool) []byte {
var b0, b1 byte;
var trunc int;
p.buf.Reset();
var b0, b1 byte
var trunc int
p.buf.Reset()
Input:
for {
b, ok := p.mustgetc();
b, ok := p.mustgetc()
if !ok {
return nil
}
@ -697,21 +697,21 @@ Input:
// It is an error for ]]> to appear in ordinary text.
if b0 == ']' && b1 == ']' && b == '>' {
if cdata {
trunc = 2;
break Input;
trunc = 2
break Input
}
p.err = SyntaxError("unescaped ]]> not in CDATA section");
return nil;
p.err = SyntaxError("unescaped ]]> not in CDATA section")
return nil
}
// Stop reading text if we see a <.
if b == '<' && !cdata {
if quote >= 0 {
p.err = SyntaxError("unescaped < inside quoted string");
return nil;
p.err = SyntaxError("unescaped < inside quoted string")
return nil
}
p.ungetc('<');
break Input;
p.ungetc('<')
break Input
}
if quote >= 0 && b == byte(quote) {
break Input
@ -722,17 +722,17 @@ Input:
// its own character names with <!ENTITY ...> directives.
// Parsers are required to recognize lt, gt, amp, apos, and quot
// even if they have not been declared. That's all we allow.
var i int;
var i int
CharLoop:
for i = 0; i < len(p.tmp); i++ {
p.tmp[i], p.err = p.r.ReadByte();
p.tmp[i], p.err = p.r.ReadByte()
if p.err != nil {
if p.err == os.EOF {
p.err = SyntaxError("unexpected EOF")
}
return nil;
return nil
}
c := p.tmp[i];
c := p.tmp[i]
if c == ';' {
break
}
@ -742,131 +742,131 @@ Input:
c == '_' || c == '#' {
continue
}
p.ungetc(c);
break;
p.ungetc(c)
break
}
s := string(p.tmp[0:i]);
s := string(p.tmp[0:i])
if i >= len(p.tmp) {
if !p.Strict {
b0, b1 = 0, 0;
p.buf.WriteByte('&');
p.buf.Write(p.tmp[0:i]);
continue Input;
b0, b1 = 0, 0
p.buf.WriteByte('&')
p.buf.Write(p.tmp[0:i])
continue Input
}
p.err = SyntaxError("character entity expression &" + s + "... too long");
return nil;
p.err = SyntaxError("character entity expression &" + s + "... too long")
return nil
}
var haveText bool;
var text string;
var haveText bool
var text string
if i >= 2 && s[0] == '#' {
var n uint64;
var err os.Error;
var n uint64
var err os.Error
if i >= 3 && s[1] == 'x' {
n, err = strconv.Btoui64(s[2:], 16)
} else {
n, err = strconv.Btoui64(s[1:], 10)
}
if err == nil && n <= unicode.MaxRune {
text = string(n);
haveText = true;
text = string(n)
haveText = true
}
} else {
if r, ok := entity[s]; ok {
text = string(r);
haveText = true;
text = string(r)
haveText = true
} else if p.Entity != nil {
text, haveText = p.Entity[s]
}
}
if !haveText {
if !p.Strict {
b0, b1 = 0, 0;
p.buf.WriteByte('&');
p.buf.Write(p.tmp[0:i]);
continue Input;
b0, b1 = 0, 0
p.buf.WriteByte('&')
p.buf.Write(p.tmp[0:i])
continue Input
}
p.err = SyntaxError("invalid character entity &" + s + ";");
return nil;
p.err = SyntaxError("invalid character entity &" + s + ";")
return nil
}
p.buf.Write(strings.Bytes(text));
b0, b1 = 0, 0;
continue Input;
p.buf.Write(strings.Bytes(text))
b0, b1 = 0, 0
continue Input
}
p.buf.WriteByte(b);
b0, b1 = b1, b;
p.buf.WriteByte(b)
b0, b1 = b1, b
}
data := p.buf.Bytes();
data = data[0 : len(data)-trunc];
data := p.buf.Bytes()
data = data[0 : len(data)-trunc]
// Must rewrite \r and \r\n into \n.
w := 0;
w := 0
for r := 0; r < len(data); r++ {
b := data[r];
b := data[r]
if b == '\r' {
if r+1 < len(data) && data[r+1] == '\n' {
continue
}
b = '\n';
b = '\n'
}
data[w] = b;
w++;
data[w] = b
w++
}
return data[0:w];
return data[0:w]
}
// Get name space name: name with a : stuck in the middle.
// The part before the : is the name space identifier.
func (p *Parser) nsname() (name Name, ok bool) {
s, ok := p.name();
s, ok := p.name()
if !ok {
return
}
i := strings.Index(s, ":");
i := strings.Index(s, ":")
if i < 0 {
name.Local = s
} else {
name.Space = s[0:i];
name.Local = s[i+1:];
name.Space = s[0:i]
name.Local = s[i+1:]
}
return name, true;
return name, true
}
// Get name: /first(first|second)*/
// Do not set p.err if the name is missing (unless unexpected EOF is received):
// let the caller provide better context.
func (p *Parser) name() (s string, ok bool) {
var b byte;
var b byte
if b, ok = p.mustgetc(); !ok {
return
}
// As a first approximation, we gather the bytes [A-Za-z_:.-\x80-\xFF]*
if b < utf8.RuneSelf && !isNameByte(b) {
p.ungetc(b);
return "", false;
p.ungetc(b)
return "", false
}
p.buf.Reset();
p.buf.WriteByte(b);
p.buf.Reset()
p.buf.WriteByte(b)
for {
if b, ok = p.mustgetc(); !ok {
return
}
if b < utf8.RuneSelf && !isNameByte(b) {
p.ungetc(b);
break;
p.ungetc(b)
break
}
p.buf.WriteByte(b);
p.buf.WriteByte(b)
}
// Then we check the characters.
s = p.buf.String();
s = p.buf.String()
for i, c := range s {
if !unicode.Is(first, c) && (i == 0 || !unicode.Is(second, c)) {
p.err = SyntaxError("invalid XML name: " + s);
return "", false;
p.err = SyntaxError("invalid XML name: " + s)
return "", false
}
}
return s, true;
return s, true
}
func isNameByte(c byte) bool {

42
src/pkg/xml/xml_test.go
View file

@ -5,11 +5,11 @@
package xml
import (
"io";
"os";
"reflect";
"strings";
"testing";
"io"
"os"
"reflect"
"strings"
"testing"
)
const testInput = `
@ -146,8 +146,8 @@ var xmlInput = []string{
}
type stringReader struct {
s string;
off int;
s string
off int
}
func (r *stringReader) Read(b []byte) (n int, err os.Error) {
@ -155,29 +155,29 @@ func (r *stringReader) Read(b []byte) (n int, err os.Error) {
return 0, os.EOF
}
for r.off < len(r.s) && n < len(b) {
b[n] = r.s[r.off];
n++;
r.off++;
b[n] = r.s[r.off]
n++
r.off++
}
return;
return
}
func (r *stringReader) ReadByte() (b byte, err os.Error) {
if r.off >= len(r.s) {
return 0, os.EOF
}
b = r.s[r.off];
r.off++;
return;
b = r.s[r.off]
r.off++
return
}
func StringReader(s string) io.Reader { return &stringReader{s, 0} }
func StringReader(s string) io.Reader { return &stringReader{s, 0} }
func TestRawToken(t *testing.T) {
p := NewParser(StringReader(testInput));
p := NewParser(StringReader(testInput))
for i, want := range rawTokens {
have, err := p.RawToken();
have, err := p.RawToken()
if err != nil {
t.Fatalf("token %d: unexpected error: %s", i, err)
}
@ -188,10 +188,10 @@ func TestRawToken(t *testing.T) {
}
func TestToken(t *testing.T) {
p := NewParser(StringReader(testInput));
p := NewParser(StringReader(testInput))
for i, want := range cookedTokens {
have, err := p.Token();
have, err := p.Token()
if err != nil {
t.Fatalf("token %d: unexpected error: %s", i, err)
}
@ -203,8 +203,8 @@ func TestToken(t *testing.T) {
func TestSyntax(t *testing.T) {
for i := range xmlInput {
p := NewParser(StringReader(xmlInput[i]));
var err os.Error;
p := NewParser(StringReader(xmlInput[i]))
var err os.Error
for _, err = p.Token(); err == nil; _, err = p.Token() {
}
if _, ok := err.(SyntaxError); !ok {

66
test/bench/binary-tree-freelist.go
View file

@ -37,19 +37,19 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"flag";
"fmt";
"flag"
"fmt"
)
var n = flag.Int("n", 15, "depth")
type Node struct {
item int;
left, right *Node;
item int
left, right *Node
}
type Arena struct {
head *Node;
head *Node
}
var arena Arena
@ -61,69 +61,69 @@ func (n *Node) free() {
if n.right != nil {
n.right.free()
}
n.left = arena.head;
arena.head = n;
n.left = arena.head
arena.head = n
}
func (a *Arena) New(item int, left, right *Node) *Node {
if a.head == nil {
nodes := make([]Node, 3<<uint(*n));
nodes := make([]Node, 3<<uint(*n))
for i := 0; i < len(nodes)-1; i++ {
nodes[i].left = &nodes[i+1]
}
a.head = &nodes[0];
a.head = &nodes[0]
}
n := a.head;
a.head = a.head.left;
n.item = item;
n.left = left;
n.right = right;
return n;
n := a.head
a.head = a.head.left
n.item = item
n.left = left
n.right = right
return n
}
func bottomUpTree(item, depth int) *Node {
if depth <= 0 {
return arena.New(item, nil, nil)
}
return arena.New(item, bottomUpTree(2*item-1, depth-1), bottomUpTree(2*item, depth-1));
return arena.New(item, bottomUpTree(2*item-1, depth-1), bottomUpTree(2*item, depth-1))
}
func (n *Node) itemCheck() int {
if n.left == nil {
return n.item
}
return n.item + n.left.itemCheck() - n.right.itemCheck();
return n.item + n.left.itemCheck() - n.right.itemCheck()
}
const minDepth = 4
func main() {
flag.Parse();
flag.Parse()
maxDepth := *n;
maxDepth := *n
if minDepth+2 > *n {
maxDepth = minDepth + 2
}
stretchDepth := maxDepth + 1;
stretchDepth := maxDepth + 1
check := bottomUpTree(0, stretchDepth).itemCheck();
fmt.Printf("stretch tree of depth %d\t check: %d\n", stretchDepth, check);
check := bottomUpTree(0, stretchDepth).itemCheck()
fmt.Printf("stretch tree of depth %d\t check: %d\n", stretchDepth, check)
longLivedTree := bottomUpTree(0, maxDepth);
longLivedTree := bottomUpTree(0, maxDepth)
for depth := minDepth; depth <= maxDepth; depth += 2 {
iterations := 1 << uint(maxDepth-depth+minDepth);
check = 0;
iterations := 1 << uint(maxDepth-depth+minDepth)
check = 0
for i := 1; i <= iterations; i++ {
t := bottomUpTree(i, depth);
check += t.itemCheck();
t.free();
t = bottomUpTree(-i, depth);
check += t.itemCheck();
t.free();
t := bottomUpTree(i, depth)
check += t.itemCheck()
t.free()
t = bottomUpTree(-i, depth)
check += t.itemCheck()
t.free()
}
fmt.Printf("%d\t trees of depth %d\t check: %d\n", iterations*2, depth, check);
fmt.Printf("%d\t trees of depth %d\t check: %d\n", iterations*2, depth, check)
}
fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck());
fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck())
}

36
test/bench/binary-tree.go
View file

@ -37,56 +37,56 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"flag";
"fmt";
"flag"
"fmt"
)
var n = flag.Int("n", 15, "depth")
type Node struct {
item int;
left, right *Node;
item int
left, right *Node
}
func bottomUpTree(item, depth int) *Node {
if depth <= 0 {
return &Node{item: item}
}
return &Node{item, bottomUpTree(2*item-1, depth-1), bottomUpTree(2*item, depth-1)};
return &Node{item, bottomUpTree(2*item-1, depth-1), bottomUpTree(2*item, depth-1)}
}
func (n *Node) itemCheck() int {
if n.left == nil {
return n.item
}
return n.item + n.left.itemCheck() - n.right.itemCheck();
return n.item + n.left.itemCheck() - n.right.itemCheck()
}
const minDepth = 4
func main() {
flag.Parse();
flag.Parse()
maxDepth := *n;
maxDepth := *n
if minDepth+2 > *n {
maxDepth = minDepth + 2
}
stretchDepth := maxDepth + 1;
stretchDepth := maxDepth + 1
check := bottomUpTree(0, stretchDepth).itemCheck();
fmt.Printf("stretch tree of depth %d\t check: %d\n", stretchDepth, check);
check := bottomUpTree(0, stretchDepth).itemCheck()
fmt.Printf("stretch tree of depth %d\t check: %d\n", stretchDepth, check)
longLivedTree := bottomUpTree(0, maxDepth);
longLivedTree := bottomUpTree(0, maxDepth)
for depth := minDepth; depth <= maxDepth; depth += 2 {
iterations := 1 << uint(maxDepth-depth+minDepth);
check = 0;
iterations := 1 << uint(maxDepth-depth+minDepth)
check = 0
for i := 1; i <= iterations; i++ {
check += bottomUpTree(i, depth).itemCheck();
check += bottomUpTree(-i, depth).itemCheck();
check += bottomUpTree(i, depth).itemCheck()
check += bottomUpTree(-i, depth).itemCheck()
}
fmt.Printf("%d\t trees of depth %d\t check: %d\n", iterations*2, depth, check);
fmt.Printf("%d\t trees of depth %d\t check: %d\n", iterations*2, depth, check)
}
fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck());
fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck())
}

96
test/bench/chameneosredux.go
View file

@ -36,16 +36,16 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"flag";
"fmt";
"strconv";
"flag"
"fmt"
"strconv"
)
const (
blue = iota;
red;
yellow;
ncol;
blue = iota
red
yellow
ncol
)
var complement = [...]int{
@ -68,8 +68,8 @@ var colname = [...]string{
// information about the current state of a creature.
type info struct {
colour int; // creature's current colour.
name int; // creature's name.
colour int // creature's current colour.
name int // creature's name.
}
// exclusive access data-structure kept inside meetingplace.
@ -77,21 +77,21 @@ type info struct {
// otherwise the creature's info is stored in info, and
// it is waiting to receive its mate's information on the mate channel.
type rendez struct {
n int; // current number of encounters.
mate chan<- info; // creature waiting when non-nil.
info info; // info about creature waiting.
n int // current number of encounters.
mate chan<- info // creature waiting when non-nil.
info info // info about creature waiting.
}
// result sent by each creature at the end of processing.
type result struct {
met int;
same int;
met int
same int
}
var n = 600
func main() {
flag.Parse();
flag.Parse()
if flag.NArg() > 0 {
n, _ = strconv.Atoi(flag.Arg(0))
}
@ -101,72 +101,72 @@ func main() {
fmt.Printf("%s + %s -> %s\n", colname[c0], colname[c1], colname[complement[c0|c1<<2]])
}
}
fmt.Print("\n");
fmt.Print("\n")
pallmall([]int{blue, red, yellow});
pallmall([]int{blue, red, yellow, red, yellow, blue, red, yellow, red, blue});
pallmall([]int{blue, red, yellow})
pallmall([]int{blue, red, yellow, red, yellow, blue, red, yellow, red, blue})
}
func pallmall(cols []int) {
// invariant: meetingplace always contains a value unless a creature
// is currently dealing with it (whereupon it must put it back).
meetingplace := make(chan rendez, 1);
meetingplace <- rendez{n: 0};
meetingplace := make(chan rendez, 1)
meetingplace <- rendez{n: 0}
ended := make(chan result);
msg := "";
ended := make(chan result)
msg := ""
for i, col := range cols {
go creature(info{col, i}, meetingplace, ended);
msg += " " + colname[col];
go creature(info{col, i}, meetingplace, ended)
msg += " " + colname[col]
}
fmt.Println(msg);
tot := 0;
fmt.Println(msg)
tot := 0
// wait for all results
for _ = range (cols) {
result := <-ended;
tot += result.met;
fmt.Printf("%v%v\n", result.met, spell(result.same, true));
result := <-ended
tot += result.met
fmt.Printf("%v%v\n", result.met, spell(result.same, true))
}
fmt.Printf("%v\n\n", spell(tot, true));
fmt.Printf("%v\n\n", spell(tot, true))
}
// in this function, variables ending in 0 refer to the local creature,
// variables ending in 1 to the creature we've met.
func creature(info0 info, meetingplace chan rendez, ended chan result) {
c0 := make(chan info);
met := 0;
same := 0;
c0 := make(chan info)
met := 0
same := 0
for {
var othername int;
var othername int
// get access to rendez data and decide what to do.
switch r := <-meetingplace; {
case r.n >= n:
// if no more meetings left, then send our result data and exit.
meetingplace <- rendez{n: r.n};
ended <- result{met, same};
return;
meetingplace <- rendez{n: r.n}
ended <- result{met, same}
return
case r.mate == nil:
// no creature waiting; wait for someone to meet us,
// get their info and send our info in reply.
meetingplace <- rendez{n: r.n, info: info0, mate: c0};
info1 := <-c0;
othername = info1.name;
info0.colour = complement[info0.colour|info1.colour<<2];
meetingplace <- rendez{n: r.n, info: info0, mate: c0}
info1 := <-c0
othername = info1.name
info0.colour = complement[info0.colour|info1.colour<<2]
default:
// another creature is waiting for us with its info;
// increment meeting count,
// send them our info in reply.
r.n++;
meetingplace <- rendez{n: r.n, mate: nil};
r.mate <- info0;
othername = r.info.name;
info0.colour = complement[info0.colour|r.info.colour<<2];
r.n++
meetingplace <- rendez{n: r.n, mate: nil}
r.mate <- info0
othername = r.info.name
info0.colour = complement[info0.colour|r.info.colour<<2]
}
if othername == info0.name {
same++
}
met++;
met++
}
}
@ -176,5 +176,5 @@ func spell(n int, required bool) string {
if n == 0 && !required {
return ""
}
return spell(n/10, false) + " " + digits[n%10];
return spell(n/10, false) + " " + digits[n%10]
}

52
test/bench/fannkuch.go
View file

@ -38,8 +38,8 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"flag";
"fmt";
"flag"
"fmt"
)
var n = flag.Int("n", 7, "count")
@ -49,45 +49,45 @@ func fannkuch(n int) int {
return 0
}
n1 := n - 1;
perm := make([]int, n);
perm1 := make([]int, n);
count := make([]int, n);
n1 := n - 1
perm := make([]int, n)
perm1 := make([]int, n)
count := make([]int, n)
for i := 0; i < n; i++ {
perm1[i] = i // initial (trivial) permutation
perm1[i] = i // initial (trivial) permutation
}
r := n;
didpr := 0;
flipsMax := 0;
r := n
didpr := 0
flipsMax := 0
for {
if didpr < 30 {
for i := 0; i < n; i++ {
fmt.Printf("%d", 1+perm1[i])
}
fmt.Printf("\n");
didpr++;
fmt.Printf("\n")
didpr++
}
for ; r != 1; r-- {
count[r-1] = r
}
if perm1[0] != 0 && perm1[n1] != n1 {
flips := 0;
for i := 1; i < n; i++ { // perm = perm1
flips := 0
for i := 1; i < n; i++ { // perm = perm1
perm[i] = perm1[i]
}
k := perm1[0]; // cache perm[0] in k
for { // k!=0 ==> k>0
k := perm1[0] // cache perm[0] in k
for { // k!=0 ==> k>0
for i, j := 1, k-1; i < j; i, j = i+1, j-1 {
perm[i], perm[j] = perm[j], perm[i]
}
flips++;
flips++
// Now exchange k (caching perm[0]) and perm[k]... with care!
j := perm[k];
perm[k] = k;
k = j;
j := perm[k]
perm[k] = k
k = j
if k == 0 {
break
}
@ -99,12 +99,12 @@ func fannkuch(n int) int {
for ; r < n; r++ {
// rotate down perm[0..r] by one
perm0 := perm1[0];
perm0 := perm1[0]
for i := 0; i < r; i++ {
perm1[i] = perm1[i+1]
}
perm1[r] = perm0;
count[r]--;
perm1[r] = perm0
count[r]--
if count[r] > 0 {
break
}
@ -113,10 +113,10 @@ func fannkuch(n int) int {
return flipsMax
}
}
return 0;
return 0
}
func main() {
flag.Parse();
fmt.Printf("Pfannkuchen(%d) = %d\n", *n, fannkuch(*n));
flag.Parse()
fmt.Printf("Pfannkuchen(%d) = %d\n", *n, fannkuch(*n))
}

86
test/bench/fasta.go
View file

@ -38,28 +38,28 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"bufio";
"flag";
"os";
"strings";
"bufio"
"flag"
"os"
"strings"
)
var out *bufio.Writer
var n = flag.Int("n", 1000, "length of result")
const WIDTH = 60 // Fold lines after WIDTH bytes
const WIDTH = 60 // Fold lines after WIDTH bytes
func min(a, b int) int {
if a < b {
return a
}
return b;
return b
}
type AminoAcid struct {
p float;
c byte;
p float
c byte
}
func AccumulateProbabilities(genelist []AminoAcid) {
@ -74,28 +74,28 @@ func AccumulateProbabilities(genelist []AminoAcid) {
// After each WIDTH characters it prints a newline.
// It assumes that WIDTH <= len(s) + 1.
func RepeatFasta(s []byte, count int) {
pos := 0;
s2 := make([]byte, len(s)+WIDTH);
copy(s2, s);
copy(s2[len(s):], s);
pos := 0
s2 := make([]byte, len(s)+WIDTH)
copy(s2, s)
copy(s2[len(s):], s)
for count > 0 {
line := min(WIDTH, count);
out.Write(s2[pos : pos+line]);
out.WriteByte('\n');
pos += line;
line := min(WIDTH, count)
out.Write(s2[pos : pos+line])
out.WriteByte('\n')
pos += line
if pos >= len(s) {
pos -= len(s)
}
count -= line;
count -= line
}
}
var lastrandom uint32 = 42
const (
IM = 139968;
IA = 3877;
IC = 29573;
IM = 139968
IA = 3877
IC = 29573
)
// Each element of genelist is a struct with a character and
@ -107,31 +107,31 @@ const (
// This sequence is repeated count times.
// Between each WIDTH consecutive characters, the function prints a newline.
func RandomFasta(genelist []AminoAcid, count int) {
buf := make([]byte, WIDTH+1);
buf := make([]byte, WIDTH+1)
for count > 0 {
line := min(WIDTH, count);
line := min(WIDTH, count)
for pos := 0; pos < line; pos++ {
lastrandom = (lastrandom*IA + IC) % IM;
lastrandom = (lastrandom*IA + IC) % IM
// Integer to float conversions are faster if the integer is signed.
r := float(int32(lastrandom)) / IM;
r := float(int32(lastrandom)) / IM
for _, v := range genelist {
if v.p >= r {
buf[pos] = v.c;
break;
buf[pos] = v.c
break
}
}
}
buf[line] = '\n';
out.Write(buf[0 : line+1]);
count -= line;
buf[line] = '\n'
out.Write(buf[0 : line+1])
count -= line
}
}
func main() {
out = bufio.NewWriter(os.Stdout);
defer out.Flush();
out = bufio.NewWriter(os.Stdout)
defer out.Flush()
flag.Parse();
flag.Parse()
iub := []AminoAcid{
AminoAcid{0.27, 'a'},
@ -149,17 +149,17 @@ func main() {
AminoAcid{0.02, 'V'},
AminoAcid{0.02, 'W'},
AminoAcid{0.02, 'Y'},
};
}
homosapiens := []AminoAcid{
AminoAcid{0.3029549426680, 'a'},
AminoAcid{0.1979883004921, 'c'},
AminoAcid{0.1975473066391, 'g'},
AminoAcid{0.3015094502008, 't'},
};
}
AccumulateProbabilities(iub);
AccumulateProbabilities(homosapiens);
AccumulateProbabilities(iub)
AccumulateProbabilities(homosapiens)
alu := strings.Bytes(
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
@ -168,12 +168,12 @@ func main() {
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA");
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")
out.WriteString(">ONE Homo sapiens alu\n");
RepeatFasta(alu, 2**n);
out.WriteString(">TWO IUB ambiguity codes\n");
RandomFasta(iub, 3**n);
out.WriteString(">THREE Homo sapiens frequency\n");
RandomFasta(homosapiens, 5**n);
out.WriteString(">ONE Homo sapiens alu\n")
RepeatFasta(alu, 2**n)
out.WriteString(">TWO IUB ambiguity codes\n")
RandomFasta(iub, 3**n)
out.WriteString(">THREE Homo sapiens frequency\n")
RandomFasta(homosapiens, 5**n)
}

90
test/bench/k-nucleotide.go
View file

@ -36,71 +36,71 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"bufio";
"bytes";
"fmt";
"io/ioutil";
"os";
"sort";
"strings";
"bufio"
"bytes"
"fmt"
"io/ioutil"
"os"
"sort"
"strings"
)
var in *bufio.Reader
func count(data string, n int) map[string]int {
counts := make(map[string]int);
top := len(data) - n;
counts := make(map[string]int)
top := len(data) - n
for i := 0; i <= top; i++ {
s := data[i : i+n];
s := data[i : i+n]
if k, ok := counts[s]; ok {
counts[s] = k + 1
} else {
counts[s] = 1
}
}
return counts;
return counts
}
func countOne(data string, s string) int {
counts := count(data, len(s));
counts := count(data, len(s))
if i, ok := counts[s]; ok {
return i
}
return 0;
return 0
}
type kNuc struct {
name string;
count int;
name string
count int
}
type kNucArray []kNuc
func (kn kNucArray) Len() int { return len(kn) }
func (kn kNucArray) Swap(i, j int) { kn[i], kn[j] = kn[j], kn[i] }
func (kn kNucArray) Len() int { return len(kn) }
func (kn kNucArray) Swap(i, j int) { kn[i], kn[j] = kn[j], kn[i] }
func (kn kNucArray) Less(i, j int) bool {
if kn[i].count == kn[j].count {
return kn[i].name > kn[j].name // sort down
return kn[i].name > kn[j].name // sort down
}
return kn[i].count > kn[j].count;
return kn[i].count > kn[j].count
}
func sortedArray(m map[string]int) kNucArray {
kn := make(kNucArray, len(m));
i := 0;
kn := make(kNucArray, len(m))
i := 0
for k, v := range m {
kn[i].name = k;
kn[i].count = v;
i++;
kn[i].name = k
kn[i].count = v
i++
}
sort.Sort(kn);
return kn;
sort.Sort(kn)
return kn
}
func print(m map[string]int) {
a := sortedArray(m);
sum := 0;
a := sortedArray(m)
sum := 0
for _, kn := range a {
sum += kn.count
}
@ -110,40 +110,40 @@ func print(m map[string]int) {
}
func main() {
in = bufio.NewReader(os.Stdin);
three := strings.Bytes(">THREE ");
in = bufio.NewReader(os.Stdin)
three := strings.Bytes(">THREE ")
for {
line, err := in.ReadSlice('\n');
line, err := in.ReadSlice('\n')
if err != nil {
fmt.Fprintln(os.Stderr, "ReadLine err:", err);
os.Exit(2);
fmt.Fprintln(os.Stderr, "ReadLine err:", err)
os.Exit(2)
}
if line[0] == '>' && bytes.Equal(line[0:len(three)], three) {
break
}
}
data, err := ioutil.ReadAll(in);
data, err := ioutil.ReadAll(in)
if err != nil {
fmt.Fprintln(os.Stderr, "ReadAll err:", err);
os.Exit(2);
fmt.Fprintln(os.Stderr, "ReadAll err:", err)
os.Exit(2)
}
// delete the newlines and convert to upper case
j := 0;
j := 0
for i := 0; i < len(data); i++ {
if data[i] != '\n' {
data[j] = data[i] &^ ' '; // upper case
j++;
data[j] = data[i] &^ ' ' // upper case
j++
}
}
str := string(data[0:j]);
str := string(data[0:j])
print(count(str, 1));
fmt.Print("\n");
print(count(str, 1))
fmt.Print("\n")
print(count(str, 2));
fmt.Print("\n");
print(count(str, 2))
fmt.Print("\n")
interests := []string{"GGT", "GGTA", "GGTATT", "GGTATTTTAATT", "GGTATTTTAATTTATAGT"};
interests := []string{"GGT", "GGTA", "GGTATT", "GGTATTTTAATT", "GGTATTTTAATTTATAGT"}
for _, s := range interests {
fmt.Printf("%d %s\n", countOne(str, s), s)
}

62
test/bench/mandelbrot.go
View file

@ -37,58 +37,58 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"bufio";
"flag";
"fmt";
"os";
"bufio"
"flag"
"fmt"
"os"
)
var n = flag.Int("n", 200, "size")
func main() {
flag.Parse();
out := bufio.NewWriter(os.Stdout);
defer out.Flush();
flag.Parse()
out := bufio.NewWriter(os.Stdout)
defer out.Flush()
w := *n;
h := *n;
bit_num := 0;
byte_acc := byte(0);
const Iter = 50;
const Zero float64 = 0;
const Limit = 2.0;
w := *n
h := *n
bit_num := 0
byte_acc := byte(0)
const Iter = 50
const Zero float64 = 0
const Limit = 2.0
fmt.Fprintf(out, "P4\n%d %d\n", w, h);
fmt.Fprintf(out, "P4\n%d %d\n", w, h)
for y := 0; y < h; y++ {
for x := 0; x < w; x++ {
Zr, Zi, Tr, Ti := Zero, Zero, Zero, Zero;
Cr := (2*float64(x)/float64(w) - 1.5);
Ci := (2*float64(y)/float64(h) - 1.0);
Zr, Zi, Tr, Ti := Zero, Zero, Zero, Zero
Cr := (2*float64(x)/float64(w) - 1.5)
Ci := (2*float64(y)/float64(h) - 1.0)
for i := 0; i < Iter && (Tr+Ti <= Limit*Limit); i++ {
Zi = 2*Zr*Zi + Ci;
Zr = Tr - Ti + Cr;
Tr = Zr * Zr;
Ti = Zi * Zi;
Zi = 2*Zr*Zi + Ci
Zr = Tr - Ti + Cr
Tr = Zr * Zr
Ti = Zi * Zi
}
byte_acc <<= 1;
byte_acc <<= 1
if Tr+Ti <= Limit*Limit {
byte_acc |= 0x01
}
bit_num++;
bit_num++
if bit_num == 8 {
out.WriteByte(byte_acc);
byte_acc = 0;
bit_num = 0;
out.WriteByte(byte_acc)
byte_acc = 0
bit_num = 0
} else if x == w-1 {
byte_acc <<= uint(8 - w%8);
out.WriteByte(byte_acc);
byte_acc = 0;
bit_num = 0;
byte_acc <<= uint(8 - w%8)
out.WriteByte(byte_acc)
byte_acc = 0
bit_num = 0
}
}
}

242
test/bench/meteor-contest.go
View file

@ -37,8 +37,8 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"flag";
"fmt";
"flag"
"fmt"
)
var max_solutions = flag.Int("n", 2100, "maximum number of solutions")
@ -48,7 +48,7 @@ func boolInt(b bool) int8 {
if b {
return 1
}
return 0;
return 0
}
/* The board is a 50 cell hexagonal pattern. For . . . . .
@ -87,19 +87,19 @@ var board uint64 = 0xFFFC000000000000
*/
const (
E = iota;
ESE;
SE;
S;
SW;
WSW;
W;
WNW;
NW;
N;
NE;
ENE;
PIVOT;
E = iota
ESE
SE
S
SW
WSW
W
WNW
NW
N
NE
ENE
PIVOT
)
var piece_def = [10][4]int8{
@ -127,16 +127,16 @@ var piece_def = [10][4]int8{
* location to reduce the burden on the solve function.
*/
var (
pieces [10][50][12]uint64;
piece_counts [10][50]int;
next_cell [10][50][12]int8;
pieces [10][50][12]uint64
piece_counts [10][50]int
next_cell [10][50][12]int8
)
/* Returns the direction rotated 60 degrees clockwise */
func rotate(dir int8) int8 { return (dir + 2) % PIVOT }
func rotate(dir int8) int8 { return (dir + 2) % PIVOT }
/* Returns the direction flipped on the horizontal axis */
func flip(dir int8) int8 { return (PIVOT - dir) % PIVOT }
func flip(dir int8) int8 { return (PIVOT - dir) % PIVOT }
/* Returns the new cell index from the specified cell in the
@ -203,7 +203,7 @@ func shift(cell, dir int8) int8 {
return cell - 4
}
}
return cell;
return cell
}
/* Returns wether the specified cell and direction will land outside
@ -215,8 +215,8 @@ func out_of_bounds(cell, dir int8) bool {
case E:
return cell%5 == 4
case ESE:
i := cell % 10;
return i == 4 || i == 8 || i == 9 || cell >= 45;
i := cell % 10
return i == 4 || i == 8 || i == 9 || cell >= 45
case SE:
return cell%10 == 9 || cell >= 45
case S:
@ -224,13 +224,13 @@ func out_of_bounds(cell, dir int8) bool {
case SW:
return cell%10 == 0 || cell >= 45
case WSW:
i := cell % 10;
return i == 0 || i == 1 || i == 5 || cell >= 45;
i := cell % 10
return i == 0 || i == 1 || i == 5 || cell >= 45
case W:
return cell%5 == 0
case WNW:
i := cell % 10;
return i == 0 || i == 1 || i == 5 || cell < 5;
i := cell % 10
return i == 0 || i == 1 || i == 5 || cell < 5
case NW:
return cell%10 == 0 || cell < 5
case N:
@ -238,10 +238,10 @@ func out_of_bounds(cell, dir int8) bool {
case NE:
return cell%10 == 9 || cell < 5
case ENE:
i := cell % 10;
return i == 4 || i == 8 || i == 9 || cell < 5;
i := cell % 10
return i == 4 || i == 8 || i == 9 || cell < 5
}
return false;
return false
}
/* Rotate a piece 60 degrees clockwise */
@ -260,7 +260,7 @@ func flip_piece(piece int) {
/* Convenience function to quickly calculate all of the indices for a piece */
func calc_cell_indices(cell []int8, piece int, index int8) {
cell[0] = index;
cell[0] = index
for i := 1; i < 5; i++ {
cell[i] = shift(cell[i-1], piece_def[piece][i-1])
}
@ -279,13 +279,13 @@ func cells_fit_on_board(cell []int8, piece int) bool {
* the piece in the solve function.
*/
func minimum_of_cells(cell []int8) int8 {
minimum := cell[0];
minimum := cell[0]
for i := 1; i < 5; i++ {
if cell[i] < minimum {
minimum = cell[i]
}
}
return minimum;
return minimum
}
/* Calculate the lowest possible open cell if the piece is placed on the board.
@ -293,33 +293,33 @@ func minimum_of_cells(cell []int8) int8 {
* solve function.
*/
func first_empty_cell(cell []int8, minimum int8) int8 {
first_empty := minimum;
first_empty := minimum
for first_empty == cell[0] || first_empty == cell[1] ||
first_empty == cell[2] || first_empty == cell[3] ||
first_empty == cell[4] {
first_empty++
}
return first_empty;
return first_empty
}
/* Generate the unsigned long long int that will later be anded with the
* board to determine if it fits.
*/
func bitmask_from_cells(cell []int8) uint64 {
var piece_mask uint64;
var piece_mask uint64
for i := 0; i < 5; i++ {
piece_mask |= 1 << uint(cell[i])
}
return piece_mask;
return piece_mask
}
/* Record the piece and other important information in arrays that will
* later be used by the solve function.
*/
func record_piece(piece int, minimum int8, first_empty int8, piece_mask uint64) {
pieces[piece][minimum][piece_counts[piece][minimum]] = piece_mask;
next_cell[piece][minimum][piece_counts[piece][minimum]] = first_empty;
piece_counts[piece][minimum]++;
pieces[piece][minimum][piece_counts[piece][minimum]] = piece_mask
next_cell[piece][minimum][piece_counts[piece][minimum]] = first_empty
piece_counts[piece][minimum]++
}
@ -330,7 +330,7 @@ func fill_contiguous_space(board []int8, index int8) {
if board[index] == 1 {
return
}
board[index] = 1;
board[index] = 1
if !out_of_bounds(index, E) {
fill_contiguous_space(board, shift(index, E))
}
@ -359,17 +359,17 @@ func fill_contiguous_space(board []int8, index int8) {
* can split the board in half where both halves are viable.
*/
func has_island(cell []int8, piece int) bool {
temp_board := make([]int8, 50);
var i int;
temp_board := make([]int8, 50)
var i int
for i = 0; i < 5; i++ {
temp_board[cell[i]] = 1
}
i = 49;
i = 49
for temp_board[i] == 1 {
i--
}
fill_contiguous_space(temp_board, int8(i));
c := 0;
fill_contiguous_space(temp_board, int8(i))
c := 0
for i = 0; i < 50; i++ {
if temp_board[i] == 0 {
c++
@ -379,7 +379,7 @@ func has_island(cell []int8, piece int) bool {
(c%5 == 0 && piece == 0) {
return false
}
return true;
return true
}
@ -391,18 +391,18 @@ func has_island(cell []int8, piece int) bool {
* me the best time ;)
*/
func calc_six_rotations(piece, index int) {
cell := make([]int8, 5);
cell := make([]int8, 5)
for rotation := 0; rotation < 6; rotation++ {
if piece != 3 || rotation < 3 {
calc_cell_indices(cell, piece, int8(index));
calc_cell_indices(cell, piece, int8(index))
if cells_fit_on_board(cell, piece) && !has_island(cell, piece) {
minimum := minimum_of_cells(cell);
first_empty := first_empty_cell(cell, minimum);
piece_mask := bitmask_from_cells(cell);
record_piece(piece, minimum, first_empty, piece_mask);
minimum := minimum_of_cells(cell)
first_empty := first_empty_cell(cell, minimum)
piece_mask := bitmask_from_cells(cell)
record_piece(piece, minimum, first_empty, piece_mask)
}
}
rotate_piece(piece);
rotate_piece(piece)
}
}
@ -410,9 +410,9 @@ func calc_six_rotations(piece, index int) {
func calc_pieces() {
for piece := 0; piece < 10; piece++ {
for index := 0; index < 50; index++ {
calc_six_rotations(piece, index);
flip_piece(piece);
calc_six_rotations(piece, index);
calc_six_rotations(piece, index)
flip_piece(piece)
calc_six_rotations(piece, index)
}
}
}
@ -424,41 +424,41 @@ func calc_pieces() {
* board in the solve function.
*/
const (
ROW_MASK = 0x1F;
TRIPLE_MASK = 0x7FFF;
ROW_MASK = 0x1F
TRIPLE_MASK = 0x7FFF
)
var (
all_rows = [32]int8{0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
all_rows = [32]int8{0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
};
bad_even_rows [32][32]int8;
bad_odd_rows [32][32]int8;
bad_even_triple [32768]int8;
bad_odd_triple [32768]int8;
}
bad_even_rows [32][32]int8
bad_odd_rows [32][32]int8
bad_even_triple [32768]int8
bad_odd_triple [32768]int8
)
func rows_bad(row1, row2 int8, even bool) int8 {
/* even is referring to row1 */
var row2_shift int8;
var row2_shift int8
/* Test for blockages at same index and shifted index */
if even {
row2_shift = ((row2 << 1) & ROW_MASK) | 0x01
} else {
row2_shift = (row2 >> 1) | 0x10
}
block := ((row1 ^ row2) & row2) & ((row1 ^ row2_shift) & row2_shift);
block := ((row1 ^ row2) & row2) & ((row1 ^ row2_shift) & row2_shift)
/* Test for groups of 0's */
in_zeroes := false;
group_okay := false;
in_zeroes := false
group_okay := false
for i := uint8(0); i < 5; i++ {
if row1&(1<<i) != 0 {
if in_zeroes {
if !group_okay {
return 1
}
in_zeroes = false;
group_okay = false;
in_zeroes = false
group_okay = false
}
} else {
if !in_zeroes {
@ -472,7 +472,7 @@ func rows_bad(row1, row2 int8, even bool) int8 {
if in_zeroes {
return boolInt(!group_okay)
}
return 0;
return 0
}
/* Check for cases where three rows checked sequentially cause a false
@ -497,29 +497,29 @@ func triple_is_okay(row1, row2, row3 int, even bool) bool {
* row3: ????? ?????
*/
return ((row1 == 0x13) && (row2 == 0x11)) ||
((row1 == 0x15) && (row2 == 0x11));
((row1 == 0x15) && (row2 == 0x11))
}
func calc_rows() {
for row1 := int8(0); row1 < 32; row1++ {
for row2 := int8(0); row2 < 32; row2++ {
bad_even_rows[row1][row2] = rows_bad(row1, row2, true);
bad_odd_rows[row1][row2] = rows_bad(row1, row2, false);
bad_even_rows[row1][row2] = rows_bad(row1, row2, true)
bad_odd_rows[row1][row2] = rows_bad(row1, row2, false)
}
}
for row1 := 0; row1 < 32; row1++ {
for row2 := 0; row2 < 32; row2++ {
for row3 := 0; row3 < 32; row3++ {
result1 := bad_even_rows[row1][row2];
result2 := bad_odd_rows[row2][row3];
result1 := bad_even_rows[row1][row2]
result2 := bad_odd_rows[row2][row3]
if result1 == 0 && result2 != 0 && triple_is_okay(row1, row2, row3, true) {
bad_even_triple[row1+(row2*32)+(row3*1024)] = 0
} else {
bad_even_triple[row1+(row2*32)+(row3*1024)] = boolInt(result1 != 0 || result2 != 0)
}
result1 = bad_odd_rows[row1][row2];
result2 = bad_even_rows[row2][row3];
result1 = bad_odd_rows[row1][row2]
result2 = bad_even_rows[row2][row3]
if result1 == 0 && result2 != 0 && triple_is_okay(row1, row2, row3, false) {
bad_odd_triple[row1+(row2*32)+(row3*1024)] = 0
} else {
@ -538,11 +538,11 @@ func boardHasIslands(cell int8) int8 {
if cell >= 40 {
return 0
}
current_triple := (board >> uint((cell/5)*5)) & TRIPLE_MASK;
current_triple := (board >> uint((cell/5)*5)) & TRIPLE_MASK
if (cell/5)%2 != 0 {
return bad_odd_triple[current_triple]
}
return bad_even_triple[current_triple];
return bad_even_triple[current_triple]
}
@ -553,26 +553,26 @@ func boardHasIslands(cell int8) int8 {
* array if a solution is found.
*/
var (
avail uint16 = 0x03FF;
sol_nums [10]int8;
sol_masks [10]uint64;
solutions [2100][50]int8;
solution_count = 0;
avail uint16 = 0x03FF
sol_nums [10]int8
sol_masks [10]uint64
solutions [2100][50]int8
solution_count = 0
)
func record_solution() {
for sol_no := 0; sol_no < 10; sol_no++ {
sol_mask := sol_masks[sol_no];
sol_mask := sol_masks[sol_no]
for index := 0; index < 50; index++ {
if sol_mask&1 == 1 {
solutions[solution_count][index] = sol_nums[sol_no];
solutions[solution_count][index] = sol_nums[sol_no]
/* Board rotated 180 degrees is a solution too! */
solutions[solution_count+1][49-index] = sol_nums[sol_no];
solutions[solution_count+1][49-index] = sol_nums[sol_no]
}
sol_mask = sol_mask >> 1;
sol_mask = sol_mask >> 1
}
}
solution_count += 2;
solution_count += 2
}
func solve(depth, cell int8) {
@ -585,31 +585,31 @@ func solve(depth, cell int8) {
}
for piece := int8(0); piece < 10; piece++ {
var piece_no_mask uint16 = 1 << uint(piece);
var piece_no_mask uint16 = 1 << uint(piece)
if avail&piece_no_mask == 0 {
continue
}
avail ^= piece_no_mask;
max_rots := piece_counts[piece][cell];
piece_mask := pieces[piece][cell];
avail ^= piece_no_mask
max_rots := piece_counts[piece][cell]
piece_mask := pieces[piece][cell]
for rotation := 0; rotation < max_rots; rotation++ {
if board&piece_mask[rotation] == 0 {
sol_nums[depth] = piece;
sol_masks[depth] = piece_mask[rotation];
sol_nums[depth] = piece
sol_masks[depth] = piece_mask[rotation]
if depth == 9 {
/* Solution found!!!!!11!!ONE! */
record_solution();
avail ^= piece_no_mask;
return;
record_solution()
avail ^= piece_no_mask
return
}
board |= piece_mask[rotation];
board |= piece_mask[rotation]
if boardHasIslands(next_cell[piece][cell][rotation]) == 0 {
solve(depth+1, next_cell[piece][cell][rotation])
}
board ^= piece_mask[rotation];
board ^= piece_mask[rotation]
}
}
avail ^= piece_no_mask;
avail ^= piece_no_mask
}
}
@ -620,46 +620,46 @@ func pretty(b *[50]int8) {
b[i+2]+'0', b[i+3]+'0', b[i+4]+'0', b[i+5]+'0', b[i+6]+'0',
b[i+7]+'0', b[i+8]+'0', b[i+9]+'0')
}
fmt.Printf("\n");
fmt.Printf("\n")
}
/* Find smallest and largest solutions */
func smallest_largest() (smallest, largest *[50]int8) {
smallest = &solutions[0];
largest = &solutions[0];
smallest = &solutions[0]
largest = &solutions[0]
for i := 1; i < solution_count; i++ {
candidate := &solutions[i];
candidate := &solutions[i]
for j, s := range *smallest {
c := candidate[j];
c := candidate[j]
if c == s {
continue
}
if c < s {
smallest = candidate
}
break;
break
}
for j, s := range *largest {
c := candidate[j];
c := candidate[j]
if c == s {
continue
}
if c > s {
largest = candidate
}
break;
break
}
}
return;
return
}
func main() {
flag.Parse();
calc_pieces();
calc_rows();
solve(0, 0);
fmt.Printf("%d solutions found\n\n", solution_count);
smallest, largest := smallest_largest();
pretty(smallest);
pretty(largest);
flag.Parse()
calc_pieces()
calc_rows()
solve(0, 0)
fmt.Printf("%d solutions found\n\n", solution_count)
smallest, largest := smallest_largest()
pretty(smallest)
pretty(largest)
}

114
test/bench/nbody.go
View file

@ -37,94 +37,94 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"flag";
"fmt";
"math";
"flag"
"fmt"
"math"
)
var n = flag.Int("n", 1000, "number of iterations")
type Body struct {
x, y, z, vx, vy, vz, mass float64;
x, y, z, vx, vy, vz, mass float64
}
const (
solarMass = 4 * math.Pi * math.Pi;
daysPerYear = 365.24;
solarMass = 4 * math.Pi * math.Pi
daysPerYear = 365.24
)
func (b *Body) offsetMomentum(px, py, pz float64) {
b.vx = -px / solarMass;
b.vy = -py / solarMass;
b.vz = -pz / solarMass;
b.vx = -px / solarMass
b.vy = -py / solarMass
b.vz = -pz / solarMass
}
type System []*Body
func NewSystem(body []Body) System {
n := make(System, len(body));
n := make(System, len(body))
for i := 0; i < len(body); i++ {
n[i] = new(Body); // copy to avoid overwriting the inputs
*n[i] = body[i];
n[i] = new(Body) // copy to avoid overwriting the inputs
*n[i] = body[i]
}
var px, py, pz float64;
var px, py, pz float64
for _, body := range n {
px += body.vx * body.mass;
py += body.vy * body.mass;
pz += body.vz * body.mass;
px += body.vx * body.mass
py += body.vy * body.mass
pz += body.vz * body.mass
}
n[0].offsetMomentum(px, py, pz);
return n;
n[0].offsetMomentum(px, py, pz)
return n
}
func (sys System) energy() float64 {
var e float64;
var e float64
for i, body := range sys {
e += 0.5 * body.mass *
(body.vx*body.vx + body.vy*body.vy + body.vz*body.vz);
(body.vx*body.vx + body.vy*body.vy + body.vz*body.vz)
for j := i + 1; j < len(sys); j++ {
body2 := sys[j];
dx := body.x - body2.x;
dy := body.y - body2.y;
dz := body.z - body2.z;
distance := math.Sqrt(dx*dx + dy*dy + dz*dz);
e -= (body.mass * body2.mass) / distance;
body2 := sys[j]
dx := body.x - body2.x
dy := body.y - body2.y
dz := body.z - body2.z
distance := math.Sqrt(dx*dx + dy*dy + dz*dz)
e -= (body.mass * body2.mass) / distance
}
}
return e;
return e
}
func (sys System) advance(dt float64) {
for i, body := range sys {
for j := i + 1; j < len(sys); j++ {
body2 := sys[j];
dx := body.x - body2.x;
dy := body.y - body2.y;
dz := body.z - body2.z;
body2 := sys[j]
dx := body.x - body2.x
dy := body.y - body2.y
dz := body.z - body2.z
dSquared := dx*dx + dy*dy + dz*dz;
distance := math.Sqrt(dSquared);
mag := dt / (dSquared * distance);
dSquared := dx*dx + dy*dy + dz*dz
distance := math.Sqrt(dSquared)
mag := dt / (dSquared * distance)
body.vx -= dx * body2.mass * mag;
body.vy -= dy * body2.mass * mag;
body.vz -= dz * body2.mass * mag;
body.vx -= dx * body2.mass * mag
body.vy -= dy * body2.mass * mag
body.vz -= dz * body2.mass * mag
body2.vx += dx * body.mass * mag;
body2.vy += dy * body.mass * mag;
body2.vz += dz * body.mass * mag;
body2.vx += dx * body.mass * mag
body2.vy += dy * body.mass * mag
body2.vz += dz * body.mass * mag
}
}
for _, body := range sys {
body.x += dt * body.vx;
body.y += dt * body.vy;
body.z += dt * body.vz;
body.x += dt * body.vx
body.y += dt * body.vy
body.z += dt * body.vz
}
}
var (
jupiter = Body{
jupiter = Body{
x: 4.84143144246472090e+00,
y: -1.16032004402742839e+00,
z: -1.03622044471123109e-01,
@ -132,8 +132,8 @@ var (
vy: 7.69901118419740425e-03 * daysPerYear,
vz: -6.90460016972063023e-05 * daysPerYear,
mass: 9.54791938424326609e-04 * solarMass,
};
saturn = Body{
}
saturn = Body{
x: 8.34336671824457987e+00,
y: 4.12479856412430479e+00,
z: -4.03523417114321381e-01,
@ -141,8 +141,8 @@ var (
vy: 4.99852801234917238e-03 * daysPerYear,
vz: 2.30417297573763929e-05 * daysPerYear,
mass: 2.85885980666130812e-04 * solarMass,
};
uranus = Body{
}
uranus = Body{
x: 1.28943695621391310e+01,
y: -1.51111514016986312e+01,
z: -2.23307578892655734e-01,
@ -150,8 +150,8 @@ var (
vy: 2.37847173959480950e-03 * daysPerYear,
vz: -2.96589568540237556e-05 * daysPerYear,
mass: 4.36624404335156298e-05 * solarMass,
};
neptune = Body{
}
neptune = Body{
x: 1.53796971148509165e+01,
y: -2.59193146099879641e+01,
z: 1.79258772950371181e-01,
@ -159,19 +159,19 @@ var (
vy: 1.62824170038242295e-03 * daysPerYear,
vz: -9.51592254519715870e-05 * daysPerYear,
mass: 5.15138902046611451e-05 * solarMass,
};
sun = Body{
}
sun = Body{
mass: solarMass,
};
}
)
func main() {
flag.Parse();
flag.Parse()
system := NewSystem([]Body{sun, jupiter, saturn, uranus, neptune});
fmt.Printf("%.9f\n", system.energy());
system := NewSystem([]Body{sun, jupiter, saturn, uranus, neptune})
fmt.Printf("%.9f\n", system.energy())
for i := 0; i < *n; i++ {
system.advance(0.01)
}
fmt.Printf("%.9f\n", system.energy());
fmt.Printf("%.9f\n", system.energy())
}

66
test/bench/pidigits.go
View file

@ -38,20 +38,20 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"bignum";
"flag";
"fmt";
"bignum"
"flag"
"fmt"
)
var n = flag.Int("n", 27, "number of digits")
var silent = flag.Bool("s", false, "don't print result")
var (
tmp1 *bignum.Integer;
tmp2 *bignum.Integer;
numer = bignum.Int(1);
accum = bignum.Int(0);
denom = bignum.Int(1);
tmp1 *bignum.Integer
tmp2 *bignum.Integer
numer = bignum.Int(1)
accum = bignum.Int(0)
denom = bignum.Int(1)
)
func extract_digit() int64 {
@ -60,36 +60,36 @@ func extract_digit() int64 {
}
// Compute (numer * 3 + accum) / denom
tmp1 = numer.Shl(1);
bignum.Iadd(tmp1, tmp1, numer);
bignum.Iadd(tmp1, tmp1, accum);
tmp1, tmp2 := tmp1.QuoRem(denom);
tmp1 = numer.Shl(1)
bignum.Iadd(tmp1, tmp1, numer)
bignum.Iadd(tmp1, tmp1, accum)
tmp1, tmp2 := tmp1.QuoRem(denom)
// Now, if (numer * 4 + accum) % denom...
bignum.Iadd(tmp2, tmp2, numer);
bignum.Iadd(tmp2, tmp2, numer)
// ... is normalized, then the two divisions have the same result.
if tmp2.Cmp(denom) >= 0 {
return -1
}
return tmp1.Value();
return tmp1.Value()
}
func next_term(k int64) {
y2 := k*2 + 1;
y2 := k*2 + 1
tmp1 = numer.Shl(1);
bignum.Iadd(accum, accum, tmp1);
bignum.Iscale(accum, y2);
bignum.Iscale(numer, k);
bignum.Iscale(denom, y2);
tmp1 = numer.Shl(1)
bignum.Iadd(accum, accum, tmp1)
bignum.Iscale(accum, y2)
bignum.Iscale(numer, k)
bignum.Iscale(denom, y2)
}
func eliminate_digit(d int64) {
bignum.Isub(accum, accum, denom.Mul1(d));
bignum.Iscale(accum, 10);
bignum.Iscale(numer, 10);
bignum.Isub(accum, accum, denom.Mul1(d))
bignum.Iscale(accum, 10)
bignum.Iscale(numer, 10)
}
func printf(s string, arg ...) {
@ -99,28 +99,28 @@ func printf(s string, arg ...) {
}
func main() {
flag.Parse();
flag.Parse()
var m int; // 0 <= m < 10
var m int // 0 <= m < 10
for i, k := 0, int64(0); ; {
d := int64(-1);
d := int64(-1)
for d < 0 {
k++;
next_term(k);
d = extract_digit();
k++
next_term(k)
d = extract_digit()
}
printf("%c", d+'0');
printf("%c", d+'0')
i++;
m = i % 10;
i++
m = i % 10
if m == 0 {
printf("\t:%d\n", i)
}
if i >= *n {
break
}
eliminate_digit(d);
eliminate_digit(d)
}
if m > 0 {

38
test/bench/regex-dna.go
View file

@ -36,11 +36,11 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"fmt";
"io/ioutil";
"os";
"regexp";
"strings";
"fmt"
"io/ioutil"
"os"
"regexp"
"strings"
)
var variants = []string{
@ -56,7 +56,7 @@ var variants = []string{
}
type Subst struct {
pat, repl string;
pat, repl string
}
var substs = []Subst{
@ -74,34 +74,34 @@ var substs = []Subst{
}
func countMatches(pat string, bytes []byte) int {
re := regexp.MustCompile(pat);
n := 0;
re := regexp.MustCompile(pat)
n := 0
for {
e := re.Execute(bytes);
e := re.Execute(bytes)
if len(e) == 0 {
break
}
n++;
bytes = bytes[e[1]:];
n++
bytes = bytes[e[1]:]
}
return n;
return n
}
func main() {
bytes, err := ioutil.ReadFile("/dev/stdin");
bytes, err := ioutil.ReadFile("/dev/stdin")
if err != nil {
fmt.Fprintf(os.Stderr, "can't read input: %s\n", err);
os.Exit(2);
fmt.Fprintf(os.Stderr, "can't read input: %s\n", err)
os.Exit(2)
}
ilen := len(bytes);
ilen := len(bytes)
// Delete the comment lines and newlines
bytes = regexp.MustCompile("(>[^\n]+)?\n").ReplaceAll(bytes, []byte{});
clen := len(bytes);
bytes = regexp.MustCompile("(>[^\n]+)?\n").ReplaceAll(bytes, []byte{})
clen := len(bytes)
for _, s := range variants {
fmt.Printf("%s %d\n", s, countMatches(s, bytes))
}
for _, sub := range substs {
bytes = regexp.MustCompile(sub.pat).ReplaceAll(bytes, strings.Bytes(sub.repl))
}
fmt.Printf("\n%d\n%d\n%d\n", ilen, clen, len(bytes));
fmt.Printf("\n%d\n%d\n%d\n", ilen, clen, len(bytes))
}

44
test/bench/reverse-complement.go
View file

@ -36,8 +36,8 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"bufio";
"os";
"bufio"
"os"
)
const lineSize = 60
@ -62,44 +62,44 @@ var complement = [256]uint8{
}
func main() {
in := bufio.NewReader(os.Stdin);
buf := make([]byte, 1024*1024);
line, err := in.ReadSlice('\n');
in := bufio.NewReader(os.Stdin)
buf := make([]byte, 1024*1024)
line, err := in.ReadSlice('\n')
for err == nil {
os.Stdout.Write(line);
os.Stdout.Write(line)
// Accumulate reversed complement in buf[w:]
nchar := 0;
w := len(buf);
nchar := 0
w := len(buf)
for {
line, err = in.ReadSlice('\n');
line, err = in.ReadSlice('\n')
if err != nil || line[0] == '>' {
break
}
line = line[0 : len(line)-1];
nchar += len(line);
line = line[0 : len(line)-1]
nchar += len(line)
if len(line)+nchar/60+128 >= w {
nbuf := make([]byte, len(buf)*5);
copy(nbuf[len(nbuf)-len(buf):], buf);
w += len(nbuf) - len(buf);
buf = nbuf;
nbuf := make([]byte, len(buf)*5)
copy(nbuf[len(nbuf)-len(buf):], buf)
w += len(nbuf) - len(buf)
buf = nbuf
}
// This loop is the bottleneck.
for _, c := range line {
w--;
buf[w] = complement[c];
w--
buf[w] = complement[c]
}
}
// Copy down to beginning of buffer, inserting newlines.
// The loop left room for the newlines and 128 bytes of padding.
i := 0;
i := 0
for j := w; j < len(buf); j += 60 {
n := copy(buf[i:i+60], buf[j:]);
buf[i+n] = '\n';
i += n + 1;
n := copy(buf[i:i+60], buf[j:])
buf[i+n] = '\n'
i += n + 1
}
os.Stdout.Write(buf[0:i]);
os.Stdout.Write(buf[0:i])
}
}

48
test/bench/spectral-norm-parallel.go
View file

@ -37,37 +37,37 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"flag";
"fmt";
"math";
"runtime";
"flag"
"fmt"
"math"
"runtime"
)
var n = flag.Int("n", 2000, "count")
var nCPU = flag.Int("ncpu", 4, "number of cpus")
func evalA(i, j int) float64 { return 1 / float64(((i+j)*(i+j+1)/2 + i + 1)) }
func evalA(i, j int) float64 { return 1 / float64(((i+j)*(i+j+1)/2 + i + 1)) }
type Vec []float64
func (v Vec) Times(i, n int, u Vec, c chan int) {
for ; i < n; i++ {
v[i] = 0;
v[i] = 0
for j := 0; j < len(u); j++ {
v[i] += evalA(i, j) * u[j]
}
}
c <- 1;
c <- 1
}
func (v Vec) TimesTransp(i, n int, u Vec, c chan int) {
for ; i < n; i++ {
v[i] = 0;
v[i] = 0
for j := 0; j < len(u); j++ {
v[i] += evalA(j, i) * u[j]
}
}
c <- 1;
c <- 1
}
func wait(c chan int) {
@ -77,35 +77,35 @@ func wait(c chan int) {
}
func (v Vec) ATimesTransp(u Vec) {
x := make(Vec, len(u));
c := make(chan int, *nCPU);
x := make(Vec, len(u))
c := make(chan int, *nCPU)
for i := 0; i < *nCPU; i++ {
go x.Times(i*len(v) / *nCPU, (i+1)*len(v) / *nCPU, u, c)
}
wait(c);
wait(c)
for i := 0; i < *nCPU; i++ {
go v.TimesTransp(i*len(v) / *nCPU, (i+1)*len(v) / *nCPU, x, c)
}
wait(c);
wait(c)
}
func main() {
flag.Parse();
runtime.GOMAXPROCS(*nCPU);
N := *n;
u := make(Vec, N);
flag.Parse()
runtime.GOMAXPROCS(*nCPU)
N := *n
u := make(Vec, N)
for i := 0; i < N; i++ {
u[i] = 1
}
v := make(Vec, N);
v := make(Vec, N)
for i := 0; i < 10; i++ {
v.ATimesTransp(u);
u.ATimesTransp(v);
v.ATimesTransp(u)
u.ATimesTransp(v)
}
var vBv, vv float64;
var vBv, vv float64
for i := 0; i < N; i++ {
vBv += u[i] * v[i];
vv += v[i] * v[i];
vBv += u[i] * v[i]
vv += v[i] * v[i]
}
fmt.Printf("%0.9f\n", math.Sqrt(vBv/vv));
fmt.Printf("%0.9f\n", math.Sqrt(vBv/vv))
}

38
test/bench/spectral-norm.go
View file

@ -37,20 +37,20 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"flag";
"fmt";
"math";
"flag"
"fmt"
"math"
)
var n = flag.Int("n", 2000, "count")
func evalA(i, j int) float64 { return 1 / float64(((i+j)*(i+j+1)/2 + i + 1)) }
func evalA(i, j int) float64 { return 1 / float64(((i+j)*(i+j+1)/2 + i + 1)) }
type Vec []float64
func (v Vec) Times(u Vec) {
for i := 0; i < len(v); i++ {
v[i] = 0;
v[i] = 0
for j := 0; j < len(u); j++ {
v[i] += evalA(i, j) * u[j]
}
@ -59,7 +59,7 @@ func (v Vec) Times(u Vec) {
func (v Vec) TimesTransp(u Vec) {
for i := 0; i < len(v); i++ {
v[i] = 0;
v[i] = 0
for j := 0; j < len(u); j++ {
v[i] += evalA(j, i) * u[j]
}
@ -67,27 +67,27 @@ func (v Vec) TimesTransp(u Vec) {
}
func (v Vec) ATimesTransp(u Vec) {
x := make(Vec, len(u));
x.Times(u);
v.TimesTransp(x);
x := make(Vec, len(u))
x.Times(u)
v.TimesTransp(x)
}
func main() {
flag.Parse();
N := *n;
u := make(Vec, N);
flag.Parse()
N := *n
u := make(Vec, N)
for i := 0; i < N; i++ {
u[i] = 1
}
v := make(Vec, N);
v := make(Vec, N)
for i := 0; i < 10; i++ {
v.ATimesTransp(u);
u.ATimesTransp(v);
v.ATimesTransp(u)
u.ATimesTransp(v)
}
var vBv, vv float64;
var vBv, vv float64
for i := 0; i < N; i++ {
vBv += u[i] * v[i];
vv += v[i] * v[i];
vBv += u[i] * v[i]
vv += v[i] * v[i]
}
fmt.Printf("%0.9f\n", math.Sqrt(vBv/vv));
fmt.Printf("%0.9f\n", math.Sqrt(vBv/vv))
}

30
test/bench/threadring.go
View file

@ -36,9 +36,9 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
"flag";
"fmt";
"os";
"flag"
"fmt"
"os"
)
var n = flag.Int("n", 1000, "how many passes")
@ -47,25 +47,25 @@ const Nthread = 503
func f(i int, in <-chan int, out chan<- int) {
for {
n := <-in;
n := <-in
if n == 0 {
fmt.Printf("%d\n", i);
os.Exit(0);
fmt.Printf("%d\n", i)
os.Exit(0)
}
out <- n-1;
out <- n-1
}
}
func main() {
flag.Parse();
flag.Parse()
one := make(chan int); // will be input to thread 1
var in, out chan int = nil, one;
one := make(chan int) // will be input to thread 1
var in, out chan int = nil, one
for i := 1; i <= Nthread-1; i++ {
in, out = out, make(chan int);
go f(i, in, out);
in, out = out, make(chan int)
go f(i, in, out)
}
go f(Nthread, out, one);
one <- *n;
<-make(chan int); // hang until ring completes
go f(Nthread, out, one)
one <- *n
<-make(chan int) // hang until ring completes
}