From e70cedfaece8b51babad7b4aa4ae9f386bb37199 Mon Sep 17 00:00:00 2001 From: Rob Pike Date: Wed, 18 Nov 2009 15:24:24 -0800 Subject: [PATCH] remove bytes.Copy replace all calls with calls to copy use copy in regexp and bytes.Buffer R=rsc CC=golang-dev https://golang.org/cl/157073 --- src/cmd/cgo/util.go | 3 +- src/pkg/archive/tar/writer.go | 31 ++++--- src/pkg/bytes/buffer.go | 7 +- src/pkg/bytes/bytes.go | 20 +---- src/pkg/bytes/bytes_test.go | 30 ------- src/pkg/compress/flate/deflate.go | 5 +- src/pkg/crypto/rsa/pkcs1v15.go | 7 +- src/pkg/crypto/rsa/rsa.go | 7 +- src/pkg/crypto/subtle/constant_time_test.go | 7 +- src/pkg/crypto/tls/handshake_messages.go | 20 ++--- src/pkg/crypto/tls/prf.go | 19 +++-- src/pkg/crypto/tls/record_process.go | 5 +- src/pkg/crypto/tls/tls.go | 3 +- src/pkg/encoding/ascii85/ascii85.go | 5 +- src/pkg/encoding/base64/base64.go | 5 +- src/pkg/encoding/git85/git.go | 4 +- src/pkg/regexp/regexp.go | 22 ++--- src/pkg/strconv/decimal.go | 10 +-- src/pkg/testing/iotest/reader.go | 3 +- src/pkg/xml/xml.go | 12 +-- test/bench/fasta.go | 89 ++++++++++----------- test/bench/reverse-complement.go | 51 ++++++------ 22 files changed, 147 insertions(+), 218 deletions(-) diff --git a/src/cmd/cgo/util.go b/src/cmd/cgo/util.go index d91516eb9d5..9e9d9aef1e8 100644 --- a/src/cmd/cgo/util.go +++ b/src/cmd/cgo/util.go @@ -5,7 +5,6 @@ package main import ( - "bytes"; "exec"; "fmt"; "go/token"; @@ -20,7 +19,7 @@ func (r ByteReaderAt) ReadAt(p []byte, off int64) (n int, err os.Error) { if off >= int64(len(r)) || off < 0 { return 0, os.EOF } - return bytes.Copy(p, r[off:len(r)]), nil; + return copy(p, r[off:len(r)]), nil; } // run runs the command argv, feeding in stdin on standard input. diff --git a/src/pkg/archive/tar/writer.go b/src/pkg/archive/tar/writer.go index 3410aa86b11..2c207d618f1 100644 --- a/src/pkg/archive/tar/writer.go +++ b/src/pkg/archive/tar/writer.go @@ -8,7 +8,6 @@ package tar // - catch more errors (no first header, write after close, etc.) import ( - "bytes"; "io"; "os"; "strconv"; @@ -124,25 +123,25 @@ func (tw *Writer) WriteHeader(hdr *Header) os.Error { s := slicer(header); // TODO(dsymonds): handle names longer than 100 chars - bytes.Copy(s.next(100), strings.Bytes(hdr.Name)); + copy(s.next(100), strings.Bytes(hdr.Name)); - tw.octal(s.next(8), hdr.Mode); // 100:108 - tw.numeric(s.next(8), hdr.Uid); // 108:116 - tw.numeric(s.next(8), hdr.Gid); // 116:124 - tw.numeric(s.next(12), hdr.Size); // 124:136 - tw.numeric(s.next(12), hdr.Mtime); // 136:148 - s.next(8); // chksum (148:156) - s.next(1)[0] = hdr.Typeflag; // 156:157 - s.next(100); // linkname (157:257) - bytes.Copy(s.next(8), strings.Bytes("ustar\x0000")); // 257:265 - tw.cString(s.next(32), hdr.Uname); // 265:297 - tw.cString(s.next(32), hdr.Gname); // 297:329 - tw.numeric(s.next(8), hdr.Devmajor); // 329:337 - tw.numeric(s.next(8), hdr.Devminor); // 337:345 + tw.octal(s.next(8), hdr.Mode); // 100:108 + tw.numeric(s.next(8), hdr.Uid); // 108:116 + tw.numeric(s.next(8), hdr.Gid); // 116:124 + tw.numeric(s.next(12), hdr.Size); // 124:136 + tw.numeric(s.next(12), hdr.Mtime); // 136:148 + s.next(8); // chksum (148:156) + s.next(1)[0] = hdr.Typeflag; // 156:157 + s.next(100); // linkname (157:257) + copy(s.next(8), strings.Bytes("ustar\x0000")); // 257:265 + tw.cString(s.next(32), hdr.Uname); // 265:297 + tw.cString(s.next(32), hdr.Gname); // 297:329 + tw.numeric(s.next(8), hdr.Devmajor); // 329:337 + tw.numeric(s.next(8), hdr.Devminor); // 337:345 // Use the GNU magic instead of POSIX magic if we used any GNU extensions. if tw.usedBinary { - bytes.Copy(header[257:265], strings.Bytes("ustar \x00")) + copy(header[257:265], strings.Bytes("ustar \x00")) } // The chksum field is terminated by a NUL and a space. diff --git a/src/pkg/bytes/buffer.go b/src/pkg/bytes/buffer.go index 76d67e777d1..0bbc06c3236 100644 --- a/src/pkg/bytes/buffer.go +++ b/src/pkg/bytes/buffer.go @@ -20,10 +20,11 @@ func copyString(dst []byte, doff int, str string) { // Copy from bytes to byte array at offset doff. Assume there's room. func copyBytes(dst []byte, doff int, src []byte) { - for soff := 0; soff < len(src); soff++ { - dst[doff] = src[soff]; - doff++; + if len(src) == 1 { + dst[doff] = src[0]; + return; } + copy(dst[doff:len(dst)], src); } // A Buffer is a variable-sized buffer of bytes diff --git a/src/pkg/bytes/bytes.go b/src/pkg/bytes/bytes.go index 0c585bd80f8..2739c5a3fe3 100644 --- a/src/pkg/bytes/bytes.go +++ b/src/pkg/bytes/bytes.go @@ -44,20 +44,6 @@ func Equal(a, b []byte) bool { return true; } -// Copy copies bytes from src to dst, -// stopping when either all of src has been copied -// or all of dst has been filled. -// It returns the number of bytes copied. -func Copy(dst, src []byte) int { - if len(src) > len(dst) { - src = src[0:len(dst)] - } - for i, x := range src { - dst[i] = x - } - return len(src); -} - // explode splits s into an array of UTF-8 sequences, one per Unicode character (still arrays of bytes), // up to a maximum of n byte arrays. Invalid UTF-8 sequences are chopped into individual bytes. func explode(s []byte, n int) [][]byte { @@ -315,10 +301,10 @@ func Add(s, t []byte) []byte { s = s[0 : lens+lent] } else { news := make([]byte, lens+lent, resize(lens+lent)); - Copy(news, s); + copy(news, s); s = news; } - Copy(s[lens:lens+lent], t); + copy(s[lens:lens+lent], t); return s; } @@ -331,7 +317,7 @@ func AddByte(s []byte, t byte) []byte { s = s[0 : lens+1] } else { news := make([]byte, lens+1, resize(lens+1)); - Copy(news, s); + copy(news, s); s = news; } s[lens] = t; diff --git a/src/pkg/bytes/bytes_test.go b/src/pkg/bytes/bytes_test.go index 3e737cb3767..1b197e1dfb8 100644 --- a/src/pkg/bytes/bytes_test.go +++ b/src/pkg/bytes/bytes_test.go @@ -172,36 +172,6 @@ func TestSplitAfter(t *testing.T) { } } -type CopyTest struct { - a string; - b string; - n int; - res string; -} - -var copytests = []CopyTest{ - CopyTest{"", "", 0, ""}, - CopyTest{"a", "", 0, "a"}, - CopyTest{"a", "a", 1, "a"}, - CopyTest{"a", "b", 1, "b"}, - CopyTest{"xyz", "abc", 3, "abc"}, - CopyTest{"wxyz", "abc", 3, "abcz"}, - CopyTest{"xyz", "abcd", 3, "abc"}, -} - -func TestCopy(t *testing.T) { - for i := 0; i < len(copytests); i++ { - tt := copytests[i]; - dst := strings.Bytes(tt.a); - n := Copy(dst, strings.Bytes(tt.b)); - result := string(dst); - if result != tt.res || n != tt.n { - t.Errorf(`Copy(%q, %q) = %d, %q; want %d, %q`, tt.a, tt.b, n, result, tt.n, tt.res); - continue; - } - } -} - // Test case for any function which accepts and returns a byte array. // For ease of creation, we write the byte arrays as strings. type StringTest struct { diff --git a/src/pkg/compress/flate/deflate.go b/src/pkg/compress/flate/deflate.go index d861c4872e0..257bc994062 100644 --- a/src/pkg/compress/flate/deflate.go +++ b/src/pkg/compress/flate/deflate.go @@ -5,7 +5,6 @@ package flate import ( - "bytes"; "io"; "math"; "os"; @@ -128,7 +127,7 @@ func (d *deflater) fillWindow(index int) (int, os.Error) { wSize := d.windowMask + 1; if index >= wSize+wSize-(minMatchLength+maxMatchLength) { // shift the window by wSize - bytes.Copy(d.window, d.window[wSize:2*wSize]); + copy(d.window, d.window[wSize:2*wSize]); index -= wSize; d.windowEnd -= wSize; if d.blockStart >= wSize { @@ -355,7 +354,7 @@ func (d *deflater) doDeflate() (err os.Error) { // For matches this long, we don't bother inserting each individual // item into the table. index += length; - hash = (int(d.window[index]) << hashShift + int(d.window[index+1])); + hash = (int(d.window[index])< len(y) { x = x[0:len(y)] } else { y = y[0:len(x)] } if v == 1 { - bytes.Copy(x, y) + copy(x, y) } return x; } @@ -99,7 +98,7 @@ func constantTimeCopyWrapper(v int, x, y []byte) []byte { } func TestConstantTimeCopy(t *testing.T) { - err := quick.CheckEqual(constantTimeCopyWrapper, copy, nil); + err := quick.CheckEqual(constantTimeCopyWrapper, makeCopy, nil); if err != nil { t.Error(err) } diff --git a/src/pkg/crypto/tls/handshake_messages.go b/src/pkg/crypto/tls/handshake_messages.go index b9c4cc36fd1..7ad52766375 100644 --- a/src/pkg/crypto/tls/handshake_messages.go +++ b/src/pkg/crypto/tls/handshake_messages.go @@ -4,10 +4,6 @@ package tls -import ( - "bytes"; -) - type clientHelloMsg struct { raw []byte; major, minor uint8; @@ -30,9 +26,9 @@ func (m *clientHelloMsg) marshal() []byte { x[3] = uint8(length); x[4] = m.major; x[5] = m.minor; - bytes.Copy(x[6:38], m.random); + copy(x[6:38], m.random); x[38] = uint8(len(m.sessionId)); - bytes.Copy(x[39:39+len(m.sessionId)], m.sessionId); + copy(x[39:39+len(m.sessionId)], m.sessionId); y := x[39+len(m.sessionId) : len(x)]; y[0] = uint8(len(m.cipherSuites) >> 7); y[1] = uint8(len(m.cipherSuites) << 1); @@ -42,7 +38,7 @@ func (m *clientHelloMsg) marshal() []byte { } z := y[2+len(m.cipherSuites)*2 : len(y)]; z[0] = uint8(len(m.compressionMethods)); - bytes.Copy(z[1:len(z)], m.compressionMethods); + copy(z[1:len(z)], m.compressionMethods); m.raw = x; return x; @@ -112,9 +108,9 @@ func (m *serverHelloMsg) marshal() []byte { x[3] = uint8(length); x[4] = m.major; x[5] = m.minor; - bytes.Copy(x[6:38], m.random); + copy(x[6:38], m.random); x[38] = uint8(len(m.sessionId)); - bytes.Copy(x[39:39+len(m.sessionId)], m.sessionId); + copy(x[39:39+len(m.sessionId)], m.sessionId); z := x[39+len(m.sessionId) : len(x)]; z[0] = uint8(m.cipherSuite >> 8); z[1] = uint8(m.cipherSuite); @@ -156,7 +152,7 @@ func (m *certificateMsg) marshal() (x []byte) { y[0] = uint8(len(slice) >> 16); y[1] = uint8(len(slice) >> 8); y[2] = uint8(len(slice)); - bytes.Copy(y[3:len(y)], slice); + copy(y[3:len(y)], slice); y = y[3+len(slice) : len(y)]; } @@ -189,7 +185,7 @@ func (m *clientKeyExchangeMsg) marshal() []byte { x[3] = uint8(length); x[4] = uint8(len(m.ciphertext) >> 8); x[5] = uint8(len(m.ciphertext)); - bytes.Copy(x[6:len(x)], m.ciphertext); + copy(x[6:len(x)], m.ciphertext); m.raw = x; return x; @@ -221,7 +217,7 @@ func (m *finishedMsg) marshal() (x []byte) { x = make([]byte, 16); x[0] = typeFinished; x[3] = 12; - bytes.Copy(x[4:len(x)], m.verifyData); + copy(x[4:len(x)], m.verifyData); m.raw = x; return; } diff --git a/src/pkg/crypto/tls/prf.go b/src/pkg/crypto/tls/prf.go index c8cb916e86f..4009c94972b 100644 --- a/src/pkg/crypto/tls/prf.go +++ b/src/pkg/crypto/tls/prf.go @@ -5,7 +5,6 @@ package tls import ( - "bytes"; "crypto/hmac"; "crypto/md5"; "crypto/sha1"; @@ -37,7 +36,7 @@ func pHash(result, secret, seed []byte, hash hash.Hash) { if j+todo > len(result) { todo = len(result) - j } - bytes.Copy(result[j:j+todo], b); + copy(result[j:j+todo], b); j += todo; h.Reset(); @@ -52,8 +51,8 @@ func pRF11(result, secret, label, seed []byte) { hashMD5 := md5.New(); labelAndSeed := make([]byte, len(label)+len(seed)); - bytes.Copy(labelAndSeed, label); - bytes.Copy(labelAndSeed[len(label):len(labelAndSeed)], seed); + copy(labelAndSeed, label); + copy(labelAndSeed[len(label):len(labelAndSeed)], seed); s1, s2 := splitPreMasterSecret(secret); pHash(result, s1, labelAndSeed, hashMD5); @@ -81,13 +80,13 @@ var serverFinishedLabel = strings.Bytes("server finished") // 4346, section 6.3. func keysFromPreMasterSecret11(preMasterSecret, clientRandom, serverRandom []byte, macLen, keyLen int) (masterSecret, clientMAC, serverMAC, clientKey, serverKey []byte) { var seed [tlsRandomLength * 2]byte; - bytes.Copy(seed[0:len(clientRandom)], clientRandom); - bytes.Copy(seed[len(clientRandom):len(seed)], serverRandom); + copy(seed[0:len(clientRandom)], clientRandom); + copy(seed[len(clientRandom):len(seed)], serverRandom); masterSecret = make([]byte, masterSecretLength); pRF11(masterSecret, preMasterSecret, masterSecretLabel, seed[0:len(seed)]); - bytes.Copy(seed[0:len(clientRandom)], serverRandom); - bytes.Copy(seed[len(serverRandom):len(seed)], clientRandom); + copy(seed[0:len(clientRandom)], serverRandom); + copy(seed[len(serverRandom):len(seed)], clientRandom); n := 2*macLen + 2*keyLen; keyMaterial := make([]byte, n); @@ -124,8 +123,8 @@ func (h finishedHash) Write(msg []byte) (n int, err os.Error) { // message given the MD5 and SHA1 hashes of a set of handshake messages. func finishedSum(md5, sha1, label, masterSecret []byte) []byte { seed := make([]byte, len(md5)+len(sha1)); - bytes.Copy(seed, md5); - bytes.Copy(seed[len(md5):len(seed)], sha1); + copy(seed, md5); + copy(seed[len(md5):len(seed)], sha1); out := make([]byte, finishedVerifyLength); pRF11(out, masterSecret, label, seed); return out; diff --git a/src/pkg/crypto/tls/record_process.go b/src/pkg/crypto/tls/record_process.go index 3bb0cd4a03e..86b908a033c 100644 --- a/src/pkg/crypto/tls/record_process.go +++ b/src/pkg/crypto/tls/record_process.go @@ -10,7 +10,6 @@ package tls // state, or for a notification when the state changes. import ( - "bytes"; "container/list"; "crypto/subtle"; "hash"; @@ -228,8 +227,8 @@ func (p *recordProcessor) processHandshakeRecord(data []byte) { return; } newBuf := make([]byte, len(p.handshakeBuf)+len(data)); - bytes.Copy(newBuf, p.handshakeBuf); - bytes.Copy(newBuf[len(p.handshakeBuf):len(newBuf)], data); + copy(newBuf, p.handshakeBuf); + copy(newBuf[len(p.handshakeBuf):len(newBuf)], data); p.handshakeBuf = newBuf; } diff --git a/src/pkg/crypto/tls/tls.go b/src/pkg/crypto/tls/tls.go index 20b1139e0d7..8f6ad111cb4 100644 --- a/src/pkg/crypto/tls/tls.go +++ b/src/pkg/crypto/tls/tls.go @@ -6,7 +6,6 @@ package tls import ( - "bytes"; "io"; "os"; "net"; @@ -59,7 +58,7 @@ func (tls *Conn) Read(p []byte) (int, os.Error) { } } - n := bytes.Copy(p, tls.readBuf); + n := copy(p, tls.readBuf); tls.readBuf = tls.readBuf[n:len(tls.readBuf)]; return n, nil; } diff --git a/src/pkg/encoding/ascii85/ascii85.go b/src/pkg/encoding/ascii85/ascii85.go index 7f6be9a1574..ba70f3dea28 100644 --- a/src/pkg/encoding/ascii85/ascii85.go +++ b/src/pkg/encoding/ascii85/ascii85.go @@ -7,7 +7,6 @@ package ascii85 import ( - "bytes"; "io"; "os"; "strconv"; @@ -268,7 +267,7 @@ func (d *decoder) Read(p []byte) (n int, err os.Error) { for { // Copy leftover output from last decode. if len(d.out) > 0 { - n = bytes.Copy(p, d.out); + n = copy(p, d.out); d.out = d.out[n:len(d.out)]; return; } @@ -279,7 +278,7 @@ func (d *decoder) Read(p []byte) (n int, err os.Error) { ndst, nsrc, d.err = Decode(&d.outbuf, d.buf[0:d.nbuf], d.readErr != nil); if ndst > 0 { d.out = d.outbuf[0:ndst]; - d.nbuf = bytes.Copy(&d.buf, d.buf[nsrc:d.nbuf]); + d.nbuf = copy(&d.buf, d.buf[nsrc:d.nbuf]); continue; // copy out and return } } diff --git a/src/pkg/encoding/base64/base64.go b/src/pkg/encoding/base64/base64.go index b0f57f60294..b149a671531 100644 --- a/src/pkg/encoding/base64/base64.go +++ b/src/pkg/encoding/base64/base64.go @@ -6,7 +6,6 @@ package base64 import ( - "bytes"; "io"; "os"; "strconv"; @@ -279,7 +278,7 @@ func (d *decoder) Read(p []byte) (n int, err os.Error) { // Use leftover decoded output from last read. if len(d.out) > 0 { - n = bytes.Copy(p, d.out); + n = copy(p, d.out); d.out = d.out[n:len(d.out)]; return n, nil; } @@ -304,7 +303,7 @@ func (d *decoder) Read(p []byte) (n int, err os.Error) { if nw > len(p) { nw, d.end, d.err = d.enc.decode(&d.outbuf, d.buf[0:nr]); d.out = d.outbuf[0:nw]; - n = bytes.Copy(p, d.out); + n = copy(p, d.out); d.out = d.out[n:len(d.out)]; } else { n, d.end, d.err = d.enc.decode(p, d.buf[0:nr]) diff --git a/src/pkg/encoding/git85/git.go b/src/pkg/encoding/git85/git.go index 288fd748c2e..cbc78fc3c49 100644 --- a/src/pkg/encoding/git85/git.go +++ b/src/pkg/encoding/git85/git.go @@ -241,7 +241,7 @@ func (d *decoder) Read(p []byte) (n int, err os.Error) { for { // Copy leftover output from last decode. if len(d.out) > 0 { - n = bytes.Copy(p, d.out); + n = copy(p, d.out); d.out = d.out[n:len(d.out)]; return; } @@ -270,7 +270,7 @@ func (d *decoder) Read(p []byte) (n int, err os.Error) { d.err = CorruptInputError(int64(e) + d.off) } d.out = d.outbuf[0:nn]; - d.nbuf = bytes.Copy(&d.buf, d.buf[nl+1:d.nbuf]); + d.nbuf = copy(&d.buf, d.buf[nl+1:d.nbuf]); d.off += int64(nl + 1); } panic("unreacahable"); diff --git a/src/pkg/regexp/regexp.go b/src/pkg/regexp/regexp.go index 89300be96cb..b70fa947999 100644 --- a/src/pkg/regexp/regexp.go +++ b/src/pkg/regexp/regexp.go @@ -277,9 +277,8 @@ func newParser(re *Regexp) *parser { } func special(c int) bool { - s := `\.+*?()|[]^$`; - for i := 0; i < len(s); i++ { - if c == int(s[i]) { + for _, r := range `\.+*?()|[]^$` { + if c == r { return true } } @@ -287,9 +286,8 @@ func special(c int) bool { } func specialcclass(c int) bool { - s := `\-[]`; - for i := 0; i < len(s); i++ { - if c == int(s[i]) { + for _, r := range `\-[]` { + if c == r { return true } } @@ -675,9 +673,7 @@ func (re *Regexp) addState(s []state, inst instr, match []int, pos, end int) []s } if l == cap(s) { s1 := make([]state, 2*l)[0:l]; - for i := 0; i < l; i++ { - s1[i] = s[i] - } + copy(s1, s); s = s1; } s = s[0 : l+1]; @@ -685,15 +681,11 @@ func (re *Regexp) addState(s []state, inst instr, match []int, pos, end int) []s s[l].match = match; if inst.kind() == _ALT { s1 := make([]int, 2*(re.nbra+1)); - for i := 0; i < len(s1); i++ { - s1[i] = match[i] - } + copy(s1, match); s = re.addState(s, inst.(*_Alt).left, s1, pos, end); // give other branch a copy of this match vector s1 = make([]int, 2*(re.nbra+1)); - for i := 0; i < len(s1); i++ { - s1[i] = match[i] - } + copy(s1, match); s = re.addState(s, inst.next(), s1, pos, end); } return s; diff --git a/src/pkg/strconv/decimal.go b/src/pkg/strconv/decimal.go index d39419bd95a..04caedb6d2e 100644 --- a/src/pkg/strconv/decimal.go +++ b/src/pkg/strconv/decimal.go @@ -11,8 +11,6 @@ package strconv -import "bytes" - type decimal struct { // TODO(rsc): Can make d[] a bit smaller and add // truncated bool; @@ -43,18 +41,18 @@ func (a *decimal) String() string { buf[w] = '.'; w++; w += digitZero(buf[w : w+-a.dp]); - w += bytes.Copy(buf[w:w+a.nd], a.d[0:a.nd]); + w += copy(buf[w:w+a.nd], a.d[0:a.nd]); case a.dp < a.nd: // decimal point in middle of digits - w += bytes.Copy(buf[w:w+a.dp], a.d[0:a.dp]); + w += copy(buf[w:w+a.dp], a.d[0:a.dp]); buf[w] = '.'; w++; - w += bytes.Copy(buf[w:w+a.nd-a.dp], a.d[a.dp:a.nd]); + w += copy(buf[w:w+a.nd-a.dp], a.d[a.dp:a.nd]); default: // zeros fill space between digits and decimal point - w += bytes.Copy(buf[w:w+a.nd], a.d[0:a.nd]); + w += copy(buf[w:w+a.nd], a.d[0:a.nd]); w += digitZero(buf[w : w+a.dp-a.nd]); } return string(buf[0:w]); diff --git a/src/pkg/testing/iotest/reader.go b/src/pkg/testing/iotest/reader.go index 61da735de6c..ce2da08b035 100644 --- a/src/pkg/testing/iotest/reader.go +++ b/src/pkg/testing/iotest/reader.go @@ -9,7 +9,6 @@ package iotest import ( "io"; "os"; - "bytes"; ) // OneByteReader returns a Reader that implements @@ -63,7 +62,7 @@ func (r *dataErrReader) Read(p []byte) (n int, err os.Error) { if n > 0 { break } - n = bytes.Copy(p, r.unread); + n = copy(p, r.unread); r.unread = r.unread[n:len(r.unread)]; } return; diff --git a/src/pkg/xml/xml.go b/src/pkg/xml/xml.go index 202cd462622..c3b91fd5fa9 100644 --- a/src/pkg/xml/xml.go +++ b/src/pkg/xml/xml.go @@ -65,19 +65,19 @@ type EndElement struct { // the characters they represent. type CharData []byte -func copy(b []byte) []byte { +func makeCopy(b []byte) []byte { b1 := make([]byte, len(b)); - bytes.Copy(b1, b); + copy(b1, b); return b1; } -func (c CharData) Copy() CharData { return CharData(copy(c)) } +func (c CharData) Copy() CharData { return CharData(makeCopy(c)) } // A Comment represents an XML comment of the form . // The bytes do not include the comment markers. type Comment []byte -func (c Comment) Copy() Comment { return Comment(copy(c)) } +func (c Comment) Copy() Comment { return Comment(makeCopy(c)) } // A ProcInst represents an XML processing instruction of the form type ProcInst struct { @@ -86,7 +86,7 @@ type ProcInst struct { } func (p ProcInst) Copy() ProcInst { - p.Inst = copy(p.Inst); + p.Inst = makeCopy(p.Inst); return p; } @@ -94,7 +94,7 @@ func (p ProcInst) Copy() ProcInst { // The bytes do not include the markers. type Directive []byte -func (d Directive) Copy() Directive { return Directive(copy(d)) } +func (d Directive) Copy() Directive { return Directive(makeCopy(d)) } type readByter interface { ReadByte() (b byte, err os.Error); diff --git a/test/bench/fasta.go b/test/bench/fasta.go index 52a55447e49..8855d6bb5ff 100644 --- a/test/bench/fasta.go +++ b/test/bench/fasta.go @@ -39,7 +39,6 @@ package main import ( "bufio"; - "bytes"; "flag"; "os"; "strings"; @@ -55,7 +54,7 @@ func min(a, b int) int { if a < b { return a } - return b + return b; } type AminoAcid struct { @@ -63,23 +62,23 @@ type AminoAcid struct { c byte; } -var lastrandom uint32 = 42 +var lastrandom uint32 = 42 // Random number between 0.0 and 1.0 func myrandom() float { const ( - IM = 139968; - IA = 3877; - IC = 29573; + IM = 139968; + IA = 3877; + IC = 29573; ) - lastrandom = (lastrandom * IA + IC) % IM; + lastrandom = (lastrandom*IA + IC) % IM; // Integer to float conversions are faster if the integer is signed. return float(int32(lastrandom)) / IM; } func AccumulateProbabilities(genelist []AminoAcid) { for i := 1; i < len(genelist); i++ { - genelist[i].p += genelist[i-1].p; + genelist[i].p += genelist[i-1].p } } @@ -90,16 +89,16 @@ func AccumulateProbabilities(genelist []AminoAcid) { // It assumes that WIDTH <= len(s) + 1. func RepeatFasta(s []byte, count int) { pos := 0; - s2 := make([]byte, len(s) + WIDTH); - bytes.Copy(s2, s); - bytes.Copy(s2[len(s):len(s2)], s); + s2 := make([]byte, len(s)+WIDTH); + copy(s2, s); + copy(s2[len(s):len(s2)], s); for count > 0 { line := min(WIDTH, count); - out.Write(s2[pos:pos+line]); + out.Write(s2[pos : pos+line]); out.WriteByte('\n'); pos += line; if pos >= len(s) { - pos -= len(s); + pos -= len(s) } count -= line; } @@ -114,7 +113,7 @@ func RepeatFasta(s []byte, count int) { // This sequence is repeated count times. // Between each WIDTH consecutive characters, the function prints a newline. func RandomFasta(genelist []AminoAcid, count int) { - buf := make([]byte, WIDTH + 1); + buf := make([]byte, WIDTH+1); for count > 0 { line := min(WIDTH, count); for pos := 0; pos < line; pos++ { @@ -125,7 +124,7 @@ func RandomFasta(genelist []AminoAcid, count int) { buf[pos] = genelist[i].c; } buf[line] = '\n'; - out.Write(buf[0:line + 1]); + out.Write(buf[0 : line+1]); count -= line; } } @@ -136,29 +135,29 @@ func main() { flag.Parse(); - iub := []AminoAcid { - AminoAcid{ 0.27, 'a' }, - AminoAcid{ 0.12, 'c' }, - AminoAcid{ 0.12, 'g' }, - AminoAcid{ 0.27, 't' }, - AminoAcid{ 0.02, 'B' }, - AminoAcid{ 0.02, 'D' }, - AminoAcid{ 0.02, 'H' }, - AminoAcid{ 0.02, 'K' }, - AminoAcid{ 0.02, 'M' }, - AminoAcid{ 0.02, 'N' }, - AminoAcid{ 0.02, 'R' }, - AminoAcid{ 0.02, 'S' }, - AminoAcid{ 0.02, 'V' }, - AminoAcid{ 0.02, 'W' }, - AminoAcid{ 0.02, 'Y' } + iub := []AminoAcid{ + AminoAcid{0.27, 'a'}, + AminoAcid{0.12, 'c'}, + AminoAcid{0.12, 'g'}, + AminoAcid{0.27, 't'}, + AminoAcid{0.02, 'B'}, + AminoAcid{0.02, 'D'}, + AminoAcid{0.02, 'H'}, + AminoAcid{0.02, 'K'}, + AminoAcid{0.02, 'M'}, + AminoAcid{0.02, 'N'}, + AminoAcid{0.02, 'R'}, + AminoAcid{0.02, 'S'}, + AminoAcid{0.02, 'V'}, + AminoAcid{0.02, 'W'}, + AminoAcid{0.02, 'Y'}, }; - homosapiens := []AminoAcid { - AminoAcid{ 0.3029549426680, 'a' }, - AminoAcid{ 0.1979883004921, 'c' }, - AminoAcid{ 0.1975473066391, 'g' }, - AminoAcid{ 0.3015094502008, 't' } + homosapiens := []AminoAcid{ + AminoAcid{0.3029549426680, 'a'}, + AminoAcid{0.1979883004921, 'c'}, + AminoAcid{0.1975473066391, 'g'}, + AminoAcid{0.3015094502008, 't'}, }; AccumulateProbabilities(iub); @@ -166,17 +165,17 @@ func main() { alu := strings.Bytes( "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" - "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" - "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" - "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" - "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" - "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" - "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"); + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"); out.WriteString(">ONE Homo sapiens alu\n"); - RepeatFasta(alu, 2 * *n); + RepeatFasta(alu, 2**n); out.WriteString(">TWO IUB ambiguity codes\n"); - RandomFasta(iub, 3 * *n); + RandomFasta(iub, 3**n); out.WriteString(">THREE Homo sapiens frequency\n"); - RandomFasta(homosapiens, 5 * *n); + RandomFasta(homosapiens, 5**n); } diff --git a/test/bench/reverse-complement.go b/test/bench/reverse-complement.go index 28feed09419..a7ea8afbd62 100644 --- a/test/bench/reverse-complement.go +++ b/test/bench/reverse-complement.go @@ -37,39 +37,38 @@ package main import ( "bufio"; - "bytes"; "os"; ) -const lineSize = 60 +const lineSize = 60 -var complement = [256]uint8 { - 'A': 'T', 'a': 'T', - 'C': 'G', 'c': 'G', - 'G': 'C', 'g': 'C', - 'T': 'A', 't': 'A', - 'U': 'A', 'u': 'A', - 'M': 'K', 'm': 'K', - 'R': 'Y', 'r': 'Y', - 'W': 'W', 'w': 'W', - 'S': 'S', 's': 'S', - 'Y': 'R', 'y': 'R', - 'K': 'M', 'k': 'M', - 'V': 'B', 'v': 'B', - 'H': 'D', 'h': 'D', - 'D': 'H', 'd': 'H', - 'B': 'V', 'b': 'V', - 'N': 'N', 'n': 'N', +var complement = [256]uint8{ + 'A': 'T', 'a': 'T', + 'C': 'G', 'c': 'G', + 'G': 'C', 'g': 'C', + 'T': 'A', 't': 'A', + 'U': 'A', 'u': 'A', + 'M': 'K', 'm': 'K', + 'R': 'Y', 'r': 'Y', + 'W': 'W', 'w': 'W', + 'S': 'S', 's': 'S', + 'Y': 'R', 'y': 'R', + 'K': 'M', 'k': 'M', + 'V': 'B', 'v': 'B', + 'H': 'D', 'h': 'D', + 'D': 'H', 'd': 'H', + 'B': 'V', 'b': 'V', + 'N': 'N', 'n': 'N', } var in *bufio.Reader func reverseComplement(in []byte) []byte { - outLen := len(in) + (len(in) + lineSize -1)/lineSize; + outLen := len(in) + (len(in)+lineSize-1)/lineSize; out := make([]byte, outLen); j := 0; k := 0; - for i := len(in)-1; i >= 0; i-- { + for i := len(in) - 1; i >= 0; i-- { if k == lineSize { out[j] = '\n'; j++; @@ -106,15 +105,15 @@ func main() { top = 0; } os.Stdout.Write(line); - continue + continue; } - line = line[0:len(line)-1]; // drop newline + line = line[0 : len(line)-1]; // drop newline if top+len(line) > len(buf) { - nbuf := make([]byte, 2*len(buf) + 1024*(100+len(line))); - bytes.Copy(nbuf, buf[0:top]); + nbuf := make([]byte, 2*len(buf)+1024*(100+len(line))); + copy(nbuf, buf[0:top]); buf = nbuf; } - bytes.Copy(buf[top:len(buf)], line); + copy(buf[top:len(buf)], line); top += len(line); } output(buf[0:top]);